Labshake search
Citations for R&D Systems :
501 - 550 of 2516 citations for Recombinant Human LDLR Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Human recombinant BMP-2 and BMP-4 were purchase from R&D Systems (Minneapolis, MN). Anti-Myc and anti-HA antibodies were purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant human versican isoform V3 and lumican were from R&D Systems (Minneapolis, MN, USA). Recombinant human versican protein G1 and G3 domains (ab152303 and ab236178 ...
-
bioRxiv - Molecular Biology 2020Quote: Mice fibroblast cells (FLS) treated with 5 ng/mL recombinant human TNF (R&D Systems) for 16 hours were harvested at 95% confluence ...
-
bioRxiv - Immunology 2022Quote: ... 625 or 312.5 ng/mL recombinant human IL13Rα1-Fc chimera (R&D Systems Cat#146IR) or IL13Rα2-Fc chimera ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant epidermal growth factor (20 ng/ml; #236-EG-01M, R&D systems, USA), human recombinant fibroblast growth factor (20 ng/ml ...
-
bioRxiv - Pathology 2019Quote: ... Human recombinant PDGF-BB and TNF-α were purchased from R&D Systems (Minneapolis, MN). TRIzol ...
-
bioRxiv - Immunology 2020Quote: ... Monocytes were stimulated for 18hrs with 100U/mL recombinant human IFN-β (R&D systems) and processed for RNA extraction.
-
bioRxiv - Bioengineering 2021Quote: ... supplemented with 10 ng/mL recombinant human IL-7 (R&D Systems; Bio-techne, Inc.) until use.
-
bioRxiv - Physiology 2020Quote: ... with 2 µg of recombinant human TSG-6 (rTSG-6, R&D Systems, Minneapolis, MN) in 100 µl PBS (or with PBS alone ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10 uM SB431542 (SA) and 10 ng/mL recombinant human FGF-2 (R&D Systems) were added on D2 for 2 days ...
-
bioRxiv - Genetics 2020Quote: ... base medium supplemented with 50 ng/ml recombinant human SCF (R&D systems #255-SC), 1 μg/ml doxycycline (Sigma Aldrich #D9891) ...
-
bioRxiv - Biochemistry 2021Quote: ... recombinant human CD45 (cat no. 1430-CD-050) was from R&D Systems (Minneapolis, MN), recombinant human CD45 (cat no ...
-
bioRxiv - Cell Biology 2020Quote: ... with 25 ng/ml recombinant human WNT3A (R&D Systems, cat. no. 5036-WN-010) and 100 ng/ml Activin A (Humanzyme ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant human IL-15 and mouse IL-21 were from R&D Systems (Minneapolis, MN).
-
bioRxiv - Immunology 2020Quote: ... CF (uPA) and Recombinant human NKG2D/CD314 Fc Chimera were purchased from R&D systems. Biotin-Protein L was purchased from GenScript ...
-
bioRxiv - Bioengineering 2022Quote: ... supplemented with 50 ng/mL recombinant human vascular endothelial growth factor (VEGF; R&D Systems), 10 μM Y-27632 ...
-
bioRxiv - Cell Biology 2022Quote: ... they and their controls were treated with recombinant human CXCL12 (R&D Systems, #350-NS) in a biopolymer delivery vehicle (CellMate3D ...
-
bioRxiv - Immunology 2022Quote: ... or 10 ng/mL of recombinant human IL-1β (R&D Systems; 201-LB-005) for the indicated times ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 20 ng/mL recombinant human basic FGF (#233-FB, R&D Systems, Germany) and 10 µM Y-27632 (only for the first 24 h after passaging ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10% Fetal Bovine Serum and 100ng/ml recombinant Human M-CSF (R&D Systems) for 4 days.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were treated with 5 ng/mL recombinant human TGFβ1 (R&D Systems, 240-B) prepared according to the manufacture’s specifications ...
-
bioRxiv - Genomics 2023Quote: ... 80 ng/mL recombinant human R-spondin-1 (R&D Systems, 4645-RS-01M/CF), 100 ng/mL recombinant human FGF-2 (Peprotech ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 25 ng/ml of recombinant human VEGF-C (Cat#: 9199-VC, R&D Systems) and HUVECs were cultured in complete Endothelial Cell Growth Medium (ECGM ...
-
bioRxiv - Genomics 2023Quote: ... (Thermo Fisher Scientific)] medium supplemented with recombinant human/mouse/rat activin A (100 ng/mL; R&D Systems) for 18 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant human TGF-β2 (Cat# 302-B2-002/CF) was purchased from R&D Systems.
-
bioRxiv - Immunology 2024Quote: ... IL-12 and recombinant human TGF-β1 were purchased from R&D Systems (Abingdon, UK).
-
bioRxiv - Microbiology 2024Quote: ... BChE activity was analogously measured using 5 ng of recombinant human BChE (R&D Systems) and butyrylthiocholine iodide ...
-
bioRxiv - Cancer Biology 2022Quote: ... or the combination of both drugs in methylcellulose media enriched with human cytokines (recombinant human SCF, GM-CSF, G-CSF, IL-3, IL-6, Epo, #HSC005, R&D Systems). The methylcellulose mixture was plated in three replicates to 35 mm culture dishes using regular syringes with 16 gauge non-stick needles and incubated at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: Primary human lung fibroblasts (passages 3-9) were exposed to 5ng/ml recombinant human TGF-β1 (R&D Systems, 240-B-002), 180μM H2O2 (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were treated with recombinant GREM1 and/or BMP4 proteins (R&D Systems) for a minimum of 24 hrs.
-
bioRxiv - Physiology 2021Quote: ... mouse recombinant active HGF protein (2207-HG) was purchased from R&D systems, mouse Ultra-Sensitive Insulin Elisa was purchased from Crystal Chem Inc (Cat # 90080) ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant Mouse TRANCE/RANK L/TNFSF11 Protein (cat# 462-TR, R&D Systems)
-
bioRxiv - Immunology 2021Quote: ... Recombinant mouse protein C and factor Xa were obtained from R&D Systems, Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% ITS+premix and 100 ng/ml recombinant CCL2 protein (R&D Systems) or 1% bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant rat beta-NGF Protein (50ng/ml, R&D systems, Cat# 556-NG). NeutrAvidin (Thermo Fisher Scientific ...
-
Targeting adipocyte ESRRA promotes osteogenesis and vascular formation in adipocyte-rich bone marrowbioRxiv - Molecular Biology 2023Quote: ... 0.5 μg/m recombinant LEPTIN protein (rLEPTIN, R&D Systems #490-OB-01M), 250 nM LEPTIN receptor antagonist Allo-aca (MCE #HY-P3212 ...
-
bioRxiv - Microbiology 2023Quote: ... coli were incubated with serial dilutions of HMGB1 recombinant protein (R&D systems) reconstituted in 1mM DTT ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bmp7 recombinant protein 0.4 μg/mL (R&D Systems 5666-BP-010/CF), Chordin like-1 recombinant protein 0.4 μg/mL (R&D Systems 1808-NR-050/CF) ...
-
Lysyl oxidase regulates epithelial differentiation and barrier integrity in eosinophilic esophagitisbioRxiv - Cell Biology 2023Quote: ... 10 ng/ml recombinant BMP2 protein (R&D Systems, Inc., Minneapolis, MN, USA), or vehicle (phosphate-buffered saline for IL-13 and hydrochloride for BMP2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were incubated in the same buffer for 1 h under light agitation with the recombinant murine chimera proteins containing human Fc domains and the extracellular domains of TREM2 (R&D systems, 1729-T2-050, 0.1 mg/mL) or CD14 (R&D systems ...
-
bioRxiv - Microbiology 2020Quote: ... PMA-differentiated THP-1 cells and primary human monocyte-derived macrophages (hMDMs) were either left unprimed or were primed overnight with recombinant human IFN-γ (R&D Systems) at a concentration of 100 U/mL ...
-
bioRxiv - Immunology 2021Quote: ... TF-I cells medium contained 2 ng/ml of recombinant human GM-CSF (R&D Systems). Cells have been cultured for no longer than 4 weeks after thawing and were regularly tested for Mycoplasma contamination using PCR technique and were confirmed to be negative.
-
bioRxiv - Immunology 2021Quote: ... were coated with recombinant human CTLA-4-Fc (7268-CT, R&D Systems, Minneapolis, MN, USA) at 1 μg/mL overnight at 4°C ...
-
bioRxiv - Genomics 2019Quote: ... and 10 ng/ml recombinant human transforming growth factor beta 3 (rhTGF-b3) (R&D Systems). Pellets were formed at the end of passage 6 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/mL recombinant human insulin-like growth factor 1 (IGF-1) (R&D Systems, USA), and 10 μM SB431542 (Tocris ...
-
bioRxiv - Bioengineering 2021Quote: ... and recombinant human ST6Gal sialyltransferase 1/ST6GAL1 (aa 44-406) from R&D Systems (Bio-techne). FabRICATOR enzyme was purchased from Genovis.
-
bioRxiv - Cancer Biology 2022Quote: ... When testing the effects of human recombinant FN1 (rFN1) (R&D Systems Catalog number: 4305-FNB), rFN1 was prepared in serum free DMEM at the concentration of either 10 ng/mL or 20 ng/mL ...
-
bioRxiv - Immunology 2019Quote: ... following relevant treatment with or without 200 U/ml of recombinant human TNF (R&D Systems). Protein concentration was measured using the Bradford assay (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human ubiquitin-activating enzyme E1 (UBE1) was purchased from R&D systems (Cat. # E-305). Recombinant human UbcH5a was purchased from R&D systems (Cat ...