Labshake search
Citations for Santa Cruz :
301 - 328 of 328 citations for Rat TUT1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... two pairs of mouse CCN4 double nickase plasmids that target the mouse CCN4 gene at different locations were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2020Quote: Human T cells (2-5 x 106) were transfected with 3 μg of TERT KO CRISPR/Cas9 plasmid (h) (sc-400316, Santa Cruz) according to the manufacturer instructions ...
-
bioRxiv - Immunology 2020Quote: PD-L1 knockout was achieved with CRISPR/Cas9 genome editing without antibiotic selection using commercially available plasmids for human (Synthego) and murine (Santa Cruz) cells ...
-
bioRxiv - Neuroscience 2022Quote: The SPPL2b gene was knocked out in HEK293 WT cells by using the SPPL2b CRISPR/Cas9 Knockout Plasmid kit from Santa Cruz Biotechnology® (sc-405646) ...
-
bioRxiv - Cell Biology 2022Quote: ... Mac-1-HEK293 cells in which CD47 gene expression was disrupted were generated using CD47 CRISPR/Cas9 KO Plasmid (h) obtained from Santa Cruz Biotechnology (catalog #sc-400508) ...
-
bioRxiv - Cancer Biology 2023Quote: HCT116 p53 null or knockout cells were used as parent cell line to generate a short telomere version using commercial hTERC knockdown plasmid and a scrambled control from Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2024Quote: ... all AGPS KO single cell clones were generated via transient transfection with mouse AGPS CRISPR/Cas9 KO Plasmids (Catalog no. sc-432759, Santa Cruz) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pik3ca-/- (αKO) KPC cell lines were generated by transfecting WT KPC cells with Pik3ca CRISPR/Cas9 αKO and HDR plasmids (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected with S1R-GFP plasmids and stained with primary (anti-GFP, ab13970, 1:500, Abcam and anti-TOM20, FL-145, 1:500, Santa Cruz Biotechnology) and secondary antibodies (488 goat anti-chicken ...
-
bioRxiv - Cancer Biology 2022Quote: ... The stable ROR2 knockout JNK reporter AGS cell line was generated by transfection first with the validated ROR2 CRISPR plasmids sc-401324 (Santa Cruz Biotechnology). ROR2 knockout clones were confirmed by sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: β-catenin knockout cells were generated via transient transfection with a CRISPR/Cas9 Ctnnb1 KO plasmid according to the manufacturer’s instructions (Santa Cruz, sc-419477). For knock-out validation ...
-
bioRxiv - Immunology 2021Quote: ... siRNA plasmid against hDlg1 (sc-36452) and hSHP1 (sc-36490)and agarose-conjugated CD3-ζ mouse monoclonal IgG1 (1239-AC) from Santa Cruz, California,USA ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Genomics 2022Quote: Parental U2OS and RPE-1 cells were seeded in 6-well plates and the next day transfected with RFX7 CRISPR/Cas9 KO Plasmid (#sc-408041, Santa Cruz Biotechnology) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: Rab27B was knocked out in the human colon cancer cell line HCT116 using Rab27B CRISPR/Cas9 KO plasmid (sc-403498; Santa Cruz Biotechnology), followed by insertion of a homology-directed repair (HDR ...
-
bioRxiv - Molecular Biology 2020Quote: Ishikawa cells were grown in a 6-well plate in full media and co-transfected with the PEA3 (alias for ETV4) CRISPR/Cas9 KO plasmid (Santa Cruz, sc-422185) and the PEA3 HDR plasmid (Santa Cruz ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 μg of total membrane protein in membrane vesicles of MQ614 harboring the indicated MhsT variant (or the control plasmid) were subjected to 11 % SDS-PAGE followed by incubation of the membrane with the His probe antibody (Santa Cruz Biotechnology, Inc.) and horseradish peroxidase-based chemiluminescence detection (SuperSignal® West Pico kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... Luc-KPV+/+ cells were transfected with a commercially available CRISPR/Cas9 vimentin knockout plasmid according to manufacturer’s directions (Santa Cruz Biotechnology sc-423676).
-
bioRxiv - Molecular Biology 2023Quote: CRISPR-Cas9-mediated genome editing was performed transfecting DC fibroblasts with Fyn and control Double Nickase human Plasmids (Santa Cruz Biotechnology, Table EV6). according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... BT549 and 4T1 cell lines with PI4KIIIβ deletion by CRISPR/Cas9 were generated by transfecting wildtype cells with CRISPR/Cas9 plasmid (Santa Cruz Biotechnology, Mississauga, Canada) followed by single cell FACS of green fluorescent cells into 96-well plates ...
-
bioRxiv - Cancer Biology 2019Quote: ... αKO KPC cells lacking CD80 (referred to as αKO/CD80KO) were generated by transfecting αKO cells with B7-1 CRISPR/Cas9 KO plasmid (Santa Cruz Biotechnology, sc-419570). 48 hours after transfection ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: HEK293 YAP-/- were generated using commercially available plasmids with specific CRISPR-Cas-9 single guide RNA (sgRNA) and sequence for homology-directed repair targeting YAP sequence (Santa Cruz Biotechnology, Dallas, TX, USA) as previously reported 36 ...
-
bioRxiv - Neuroscience 2022Quote: ... On the day of the transfection two separate solutions were prepared: Solution A was made by adding 2 μg of plasmid DNA (Santa Cruz Biotechnology ®, sc-405646) into 130 μl of plasmid transfection medium (Santa Cruz Biotechnology ® ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR/Cas9 genome editing was used to target SNCA in SK-MEL-29 cells as described previously 30 for SK-MEL-28 cells using α-syn CRISPR/Cas9 knockout plasmid (Santa Cruz Biotechnology # sc-417273-NIC). Lentivirus particles expressing human α-syn under cytomegalovirus (CMV ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR/Cas9 genome editing was used to target SNCA in WM983B cells as described previously for SK-MEL-28 cells27 using α-syn CRISPR/Cas9 knockout plasmid (Santa Cruz Biotechnology # sc-417273-NIC). Lentivirus particles expressing human α-syn under cytomegalovirus (CMV ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% CO2.GIV knock-out (KO) cell lines were generated using Pooled guide RNA plasmids (commercially obtained from Santa Cruz Biotechnology; Cat# sc-402236-KO-2), as described earlier(67) ...