Labshake search
Citations for Santa Cruz :
1 - 50 of 9644 citations for Mouse Receptor Interacting Serine threonine Protein Kinase 1 RIPK1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... epidermal growth factor receptor EGFR (mouse, 1:1,000 Santa Cruz Biotechnology, Dallas, TX) and β-actin (mouse ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-p70 S6 kinase alpha (Santa Cruz Biotechnology Cat# sc-8418 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-protein kinase Cγ (PKCγ [C19], Santa Cruz Biotechnology, SC-211; 1:200), guinea pig anti-NeuN (Millipore ...
-
bioRxiv - Bioengineering 2023Quote: ... and Rho associated coiled-coil containing protein kinase 2 (Santa Cruz, sc-398519, 1:100). These antibodies were labeled with fluorophore-conjugated ...
-
bioRxiv - Physiology 2019Quote: ... estrogen receptor alpha (Eralpha, mouse mAb, sc-51857, sc-8002, Santa Cruz Biotechnology, 1:250), filaggrin (rabbit pAb ...
-
bioRxiv - Immunology 2021Quote: Three different RIPK1 CRISPR/Cas9 knockout plasmids (Santa Cruz sc-400377) respectively encoding guide RNA targeting sequences GGCTTTGCGTTGACGTCATTC (gRNAa) ...
-
bioRxiv - Neuroscience 2022Quote: ... or serine racemase (sc-365217, Santa Cruz). Secondary antibody (IRDye ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-CD71 (transferrin receptor, Santa Cruz Biotechnology, cat. No. sc-32272), rabbit anti-Jak1 (Cell Signaling ...
-
bioRxiv - Physiology 2022Quote: ... Protein homogenates were analyzed for abundance of ryanodine receptor (RyR; Santa Cruz 13942), Sarco/Endoplasmic Reticulum Calcium ATPase 1 (SERCA1 ...
-
bioRxiv - Physiology 2023Quote: ... interleukin 1 receptor (IL1R) (1:100, Santa Cruz Biotechnology, Madrid, Spain), tumor necrosis factor alfa receptor (TNF-αR ...
-
bioRxiv - Microbiology 2020Quote: ... complement receptor 1 (CR1, Clone J3D3, 1:50, Santa Cruz Biotechnology, USA) or Decay-accelerating factor (DAF ...
-
bioRxiv - Cell Biology 2019Quote: ... estrogen receptor (Santa Cruz sc-542, 1:20; BioRad MCA1799T, 1:25), Ltf (Bioss bs-5810 ...
-
bioRxiv - Neuroscience 2021Quote: ... Ribosomal Protein S6 (1:1000, mouse, Santa Cruz SC-74459) or GAPDH (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... SR proteins (1:100, mouse, Santa Cruz Biotechnology, sc-13509). Alexa Fluor (AF)-conjugated secondary antibodies used were ...
-
bioRxiv - Cancer Biology 2023Quote: ... IGF-1 Receptor α mAb(1H7) (Santa Cruz; #sc-461); doxycycline (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Membranes were incubated overnight in 4 °C with mouse monoclonal antibody (dilution 1:1000 in TBS-T + 5% BSA) oxytocin receptor (Cat #: sc-515809) from Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Neuroscience 2022Quote: ... goat polyclonal antibody against MBP (sc-13914) and mouse monoclonal antibody against phosphorylated serine (phospho-Ser) (sc-81514) were from Santa Cruz Biotechnology (Heidelberg ...
-
bioRxiv - Neuroscience 2020Quote: ... brains were incubated overnight with combinations of the following primary antibodies: rabbit anti-protein kinase C (anti-PKC) clone C20 (1:1000; Santa Cruz Biotechnology), rabbit anti-phospho-histone H3 (1:2500 ...
-
bioRxiv - Physiology 2023Quote: ... interleukin 6 receptor (IL6R) (1:200, Santa Cruz Biotechnology, Madrid, Spain), interleukin 1 receptor (IL1R ...
-
bioRxiv - Cell Biology 2021Quote: ... ubiquitous mitochondrial creatine kinase (uMtCK C-18, Santa Cruz, 1:500), synaptophysin (SVP38 ...
-
bioRxiv - Bioengineering 2023Quote: ... anti-mouse Yes-associated Protein (1:500, Santa Cruz Biotechnology, sc-101199), anti-mouse Neurofilament (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... retinoid-related orphan receptor alpha (RORα) and melatonin receptor 1A (MT1) from Santa Cruz Biotechnology (Santa Cruz ...
-
bioRxiv - Neuroscience 2021Quote: ... or goat anti-5-HT2A receptor (1:500, Santa Cruz Biotechnologies, USA) along with the pan-neuronal marker ...
-
bioRxiv - Molecular Biology 2021Quote: ... Casein kinase IIα (1AD9) 1:500 (Santa Cruz; catalog no. sc-12738), CKII alpha’ Antibody 1:1000 (Bethyl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Casein kinase IIα (1AD9) 1:500 (Santa Cruz; catalog no. sc-12738), CKII alpha’ antibody 1:1000 (Bethyl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or 100 μM of the protein kinase A (PKA) inhibitor Rp-8-Br-cAMPs (Santa Cruz Biotechnology)81.
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-homeodomain only protein (HOPX, 1:250, sc-398703 AF647, Santa Cruz). rat anti-KI67 (KI67 ...
-
bioRxiv - Physiology 2020Quote: ... Leptin receptor and its phosphorylated domains were evaluated using the following antibodies: mouse monoclonal (MM) against leptin receptor (ObR; 1:500, cat# sc-8391, Santa Cruz Biotechnology, Dallas, Texas, USA), goat polyclonal (GP ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and early growth response protein-1 (mouse anti-Egr-1, 1:100, Santa Cruz Biotechnology, Cat. No. sc-515830) diluted in 1% non-fat milk/TBST solutions ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-ribosomal protein phospho-S6S240/S244 (1:1000, CST #2215) and mouse anti-ribosomal protein S6 (C-8) (1:1000, Santa Cruz Technologies #sc-74459). For the detection of phosphorylated proteins goat anti-rabbit IRDye 680RD (1:15,000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were detected using c-Myc mouse monoclonal antibody (9E10, Santa Cruz, 1:500), Flag mouse monoclonal antibody (M2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were detected using c-Myc mouse monoclonal antibody (9E10, Santa Cruz, 1/500), Flag mouse monoclonal antibody (M2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... then 1 mg protein was precleared using normal mouse IgG agarose conjugate (Santa Cruz) for 2-4 hours at 4°C ...
-
DIET INFLUENCES PERIPHERAL AMYLOID β METABOLISM: A ROLE FOR CIRCULATING INSULIN-LIKE GROWTH FACTOR IbioRxiv - Neuroscience 2020Quote: ... Primary antibodies were monoclonal anti-IGF-I receptor (1:1000; Santa Cruz Biotechnology, USA), monoclonal anti-APP (Nt 22C11 ...
-
bioRxiv - Neuroscience 2020Quote: ... goat (gt)-α-RAR-related orphan receptor alpha (RORα; 1:250; Santa Cruz; #F2510); rb-α-parvalbumin (PV ...
-
bioRxiv - Physiology 2023Quote: ... tumor necrosis factor alfa receptor (TNF-αR) (1:200, Santa Cruz Biotechnology, Madrid, Spain), tumor necrosis factor alfa (TNF-α ...
-
bioRxiv - Genetics 2020Quote: ... DNA-dependent protein kinase catalytic subunit (DNA-PKcs) antibody was obtained from Santa Cruz (sc-5282, Dallas, TX, USA) and anti-phosphorylated DNA-PKcs was purchased from Abcam (ab124918 ...
-
bioRxiv - Cancer Biology 2023Quote: ... such as mouse monoclonal anti-human p53 protein DO-1 (1:200) (Santa Cruz Biotechnology, Dallas, TX, USA) or anti-human pab240 (1:500 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and CruzFluor™ 647-conjugated mouse IgG kappa binding protein (1:1000, Santa Cruz Biotechnology).
-
bioRxiv - Neuroscience 2019Quote: ... RAGE protein was detected using mouse monoclonal anti-RAGE antibody (E-1; Santa Cruz Biotech) and appropriate HRP-conjugated rabbit anti-mouse antibody at a dilution of 1:100 and 1:500 respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the following proteins were used: Anillin (Santa Cruz SC-271814; 1:200), GFP (Sigma-Aldrich 11874460001 ...
-
bioRxiv - Cancer Biology 2020Quote: Casein Kinase 2β (Santa Cruz, sc-9030)
-
bioRxiv - Cancer Biology 2020Quote: Casein Kinase 2β (Santa Cruz, sc-12739)
-
bioRxiv - Cell Biology 2022Quote: Dopamine Receptor 2 antibody (Santa Cruz Biotechnology, SC5303)
-
bioRxiv - Cell Biology 2023Quote: ... insulin receptor β antibody (CT-3) (Santa Cruz); goat anti-rabbit immunoglobulin (IgG ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-androgen receptor N-20 (rabbit polyclonal; Santa Cruz Biotechnology; #sc-816; 1:200 for IHC). Anti-phospho-MLC2-Ser19 (rabbit polyclonal ...
-
bioRxiv - Molecular Biology 2022Quote: ... Hedgehog pathway protein localization coverslips were incubated with either 1) mouse anti-SMO (1:50, Santa Cruz Biotechnology, sc-166685) and rabbit anti-ARL13B (1:800 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies for Casein kinase 2 (Santa Cruz Biotechnology), OGR1 Cat No ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rockout (Rho Kinase Inhibitor III; Santa Cruz Biotechnology) was used to inhibit Rock1/2 activity 45 ...
-
bioRxiv - Cell Biology 2022Quote: ... p70 S6 kinase (Santa Cruz Biotechnology; sc-8418), mCherry (Novus Biologicals ...