Labshake search

251 - 300 of 3836 citations for Mouse FAM117A shRNA Plasmid since 2019

• SRSF2 is required for mRNA splicing and spermatogenesis

  Wen-Long Lei, et al., bioRxiv - Developmental Biology 2022

  Quote: ... SYCP3 (mouse, sc-74569; Santa Cruz); γH2AX (rabbit ...
• CLASP2 facilitates dynamic actin filament organization along the microtubule lattice

  NC Rodgers, et al., bioRxiv - Cell Biology 2022

  Quote: ... and anti-mouse GAPDH (Santa Cruz). IRDye 700 or 800 (LI-COR Biosciences ...
• The CRL4B E3 ligase regulates mitosis by recruiting phospho-specific DCAFs

  Anna Stier, et al., bioRxiv - Cell Biology 2022

  Quote: ... Anti-LIS1 (mouse, Santa Cruz Biotechnology); Anti-Pericentrin (rabbit ...
• BCL6 regulates the endothelial pro-immunogenic phenotype relevant to organ transplant rejection

  Adriana Franco Acevedo, Nicole M Valenzuela, bioRxiv - Immunology 2022

  Quote: ... and mouse anti-STAT1 (Santa Cruz), followed by anti-rabbit-AF647 and anti-mouse-AF488 (Jackson Immuno ...
• LRBA balances antigen presentation and T-cell responses by facilitating autophagy through the binding to PIK3R4 and FYCO1

  Laura Gámez-Díaz, et al., bioRxiv - Immunology 2022

  Quote: ... or mouse anti-GFP (Santa Cruz). Then ...
• A surface pocket in the cytoplasmic domain of the herpes simplex virus fusogen gB controls membrane fusion

  Zemplen Pataki, et al., bioRxiv - Microbiology 2022

  Quote: ... or mouse (9E10, Santa Cruz Biotechnology) antibody as a non-targeting negative control for the Mock condition ...
• An isogenic human iPSC model unravels neurodevelopmental abnormalities in SMA

  Tobias Grass, et al., bioRxiv - Neuroscience 2023

  Quote: ... anti-IgG mouse (Santa Cruz, sc2025); anti-SMN (for immunofluorescence ...
• Familial Alzheimer’s disease mutation undermines axonal transport by enhancing dynactin recruitment to the APP motor assemblies

  Monica Feole, Gorazd B. Stokin, bioRxiv - Neuroscience 2022

  Quote: ... DCTN1 (mouse 1:200 Santa Cruz 135890 ...
• Glucose-stimulated KIF5B-driven microtubule sliding organizes microtubule networks in pancreatic beta cells

  Kai M. Bracey, et al., bioRxiv - Cell Biology 2023

  Quote: ... and mouse anti-GAPDH (Santa Cruz). anti-rabbit HRP and anti-mouse HRP were used as secondary antibodies and imaged on an ChemiDoc (Bio-Rad).
• Early spiral arteriole remodeling in the uterine-placental interface: a rat model

  Sarah J. Bacon, Yuxi Zhu, Priyanjali Ghosh, bioRxiv - Developmental Biology 2023

  Quote: ... mouse anti-CD31 (Santa Cruz Biotechnology) to detect endothelial cells and used at a dilution of 1:500 ...
• Enhanced mitochondrial biogenesis promotes neuroprotection in human stem cell derived retinal ganglion cells of the central nervous system

  Michelle Surma, et al., bioRxiv - Neuroscience 2022

  Quote: ... antibodies against Tom20 (Mouse, Santa Cruz) and Optineurin (Rabbit ...
• ASD modelling in organoids reveals imbalance of excitatory cortical neuron subtypes during early neurogenesis

  Alexandre Jourdon, et al., bioRxiv - Neuroscience 2023

  Quote: ... HOPX (mouse, 1:50, Santa Cruz), HuC/D (mouse ...
• A phosphorylation switch regulates RAB6 function during mitosis

  Ana Joaquina Jimenez, et al., bioRxiv - Cell Biology 2023

  Quote: ... mouse anti-Plk1 (Santa Cruz Biotechnology), mouse anti-BubR1 (BD Biosciences) ...
• Aurora B Kinase Dependent Phosphorylation of Keratin 8 is required for Cytokinesis in Mammalian Cells of Epithelial Origin

  Busra Harmanda, et al., bioRxiv - Cell Biology 2023

  Quote: ... mouse monoclonal Keratin 8 (Santa Cruz, sc-8020 ...
• Integrated Stress Response signaling acts as a metabolic sensor in fat tissues to regulate oocyte maturation and ovulation

  Lydia Grmai, et al., bioRxiv - Genetics 2023

  Quote: ... Mouse anti-KDEL (Santa Cruz Biotech) was used at 1:100 ...
• Post-translational modification of SPATULA by SECRET AGENT and SPINDLY promotes organ symmetry transition at the gynoecium apex

  Yuxiang Jiang, et al., bioRxiv - Plant Biology 2023

  Quote: ... anti-mouse (sc-516102, Santa Cruz), anti-rabbit (ab205718 ...
• Loss of PAX6 alters the excitatory/inhibitory neuronal ratio in human cerebral organoids

  Wai Kit Chan, et al., bioRxiv - Developmental Biology 2023

  Quote: ... DLX2 (mouse, sc-393879 Santa Cruz); with antigen retrieval step ...
• Oligodendroglial precursors orchestrate immune network instigating early demyelination in experimental autoimmune encephalomyelitis

  Qi Wang, et al., bioRxiv - Neuroscience 2023

  Quote: ... Mouse anti-IP3R2 (Santa Cruz, SC393434), Goat anti-Iba1 (Wako ...
• piRNAs are regulators of metabolic reprogramming in stem cells

  Patricia Rojas-Ríos, et al., bioRxiv - Developmental Biology 2023

  Quote: ... mouse anti-Eno (Santa Cruz Biotechnology) 1/100 ...
• RORγ bridges cancer-driven lipid dysmetabolism and myeloid immunosuppression

  Augusto Bleve, et al., bioRxiv - Immunology 2023

  Quote: ... goat anti-mouse actin (Santa Cruz); (secondary ...
• Genome-wide CRISPR/Cas9 screen identifies MAT2A as a critical host factor for BK Polyomavirus

  Laura Caller, et al., bioRxiv - Microbiology 2023

  Quote: ... mouse anti-MAT2A/1A (Santa Cruz Biotechnology Cat# sc-166452 ...
• The ULK1 effector BAG2 regulates autophagy initiation by modulating AMBRA1 localization

  Devanarayanan Siva Sankar, et al., bioRxiv - Cell Biology 2023

  Quote: ... BAG3 (Santa Cruz, sc-136467, mouse), BAG5 (Santa Cruz Biotechnologies ...
• Advance Glycation End-products accelerate amyloid deposits in adipocyte’s lipid droplets

  Roza Izgilov, et al., bioRxiv - Cell Biology 2023

  Quote: ... ATGL (mouse, Santa Cruz sc-365278), 4G8 (mouse ...
• Modelling variability and heterogeneity of EMT scenarios highlights nuclear positioning and protrusions as main drivers of extrusion

  Steffen Plunder, et al., bioRxiv - Developmental Biology 2023

  Quote: ... mouse anti-aPKC (Santa Cruz, sc17781). The following antibodies ...
• The ULK1 effector BAG2 regulates autophagy initiation by modulating AMBRA1 localization

  Devanarayanan Siva Sankar, et al., bioRxiv - Cell Biology 2023

  Quote: ... BAG2 (Santa Cruz, sc-390107, mouse), BAG3 (Santa Cruz ...
• Arrestin-3-assisted activation of JNK3 mediates dopaminergic behavioral and signaling plasticity in vivo

  Mohamed R. Ahmed, et al., bioRxiv - Neuroscience 2023

  Quote: ... JNK3-specific mouse (Santa Cruz Biotechnology) or rabbit anti-HA antibody (Cell Signaling ...
• Deciphering molecular heterogeneity and dynamics of neural stem cells in human hippocampal development, aging, and injury

  Junjun Yao, et al., bioRxiv - Neuroscience 2023

  Quote: ... mouse (sc-55565, Santa Cruz Biotechnology). After overnight incubation ...
• Advance Glycation End-products accelerate amyloid deposits in adipocyte’s lipid droplets

  Roza Izgilov, et al., bioRxiv - Cell Biology 2023

  Quote: ... ATGL (mouse; Santa Cruz SC-365278), 4G8 (Beta Amyloid 17-24 ...
• Evaluation of homologous recombination repair status in metastatic prostate cancer by next-generation sequencing and functional tissue-based immunofluorescence assays

  Sara Arce-Gallego, et al., bioRxiv - Cancer Biology 2024

  Quote: ... and mouse anti-BRCA1 (Santa Cruz Biotechnology Inc ...
• Localization and function of key axonemal microtubule inner proteins and dynein docking complex members reveal extensive diversity among vertebrate motile cilia

  Hao Lu, et al., bioRxiv - Developmental Biology 2024

  Quote: ... mouse anti-HA (Santa Cruz, SC7392), rabbit anti-GFP (Torrey Pines ...
• Senolytic therapy preserves blood-brain barrier integrity and promotes microglia homeostasis in a tauopathy model

  Minmin Yao, et al., bioRxiv - Neuroscience 2024

  Quote: ... P21(Santa Cruz, MOUSE,1:50). After thorough washes in PBS ...
• Dysfunctional β-cell longevity in diabetes relies on energy conservation and positive epistasis

  Kavit Raval, et al., bioRxiv - Cell Biology 2024

  Quote: ... mouse anti-c-Myc (Santa Cruz Biotechnology Inc 9E10 sc-40 ...
• Ubiquitin ligase and signalling hub MYCBP2 is required for efficient EPHB2 tyrosine kinase receptor function

  Chao Chang, et al., bioRxiv - Cell Biology 2023

  Quote: ... mouse monoclonal anti-GAPDH (Santa Cruz Biotechnology ...
• ZBP1 induces inflammatory signaling via RIPK3 and promotes SARS-CoV-2-induced cytokine expression

  Ruoshi Peng, et al., bioRxiv - Immunology 2021

  Quote: Three different RIPK1 CRISPR/Cas9 knockout plasmids (Santa Cruz sc-400377) respectively encoding guide RNA targeting sequences GGCTTTGCGTTGACGTCATTC (gRNAa) ...
• Haspin participates in Aurora phosphorylation at centromeres and contributes to chromosome congression in male mouse meiosis

  I Berenguer, et al., bioRxiv - Cell Biology 2021

  Quote: ... SYCP3 was detected with either a mouse monoclonal antibody against mouse SYCP3 (Santa Cruz Biotechnology, sc-74569) or a rabbit polyclonal antibody recognizing mouse SYCP3 (Santa Cruz Biotechnology ...
• Remodeling tumor microenvironment by liposomal co-delivery of DMXAA and simvastatin inhibits malignant melanoma progression

  Valentin-Florian Rauca, et al., bioRxiv - Cancer Biology 2021

  Quote: ... diluted 500-fold: mouse monoclonal IgG anti-mouse Bcl-xL (sc-8392, Santa Cruz Biotechnology, Texas, USA), rabbit polyclonal IgG anti-mouse Bax (2772S ...
• γ-H2AX is present at mouse meiotic kinetochores

  Andrea Guajardo, et al., bioRxiv - Cell Biology 2020

  Quote: ... Other primary antibodies were used as follows: a mouse monoclonal antibody against mouse SYCP3 (Santa Cruz, sc-74569) at 1:100 ...
• Translation Inhibitory Elements from Hox a3 and a11 mRNAs use uORFs for translation inhibition

  Fatima Alghoul, et al., bioRxiv - Biochemistry 2021

  Quote: ... mouse monoclonal anti-eIF4E antibody (sc-9976) and mouse polyclonal anti-GAPDH antibody (sc-1377179) from Santa Cruz Biotechnology ...
• Pioneer transcription factors are associated with the modulation of DNA methylation patterns across cancers

  Roza Berhanu Lemma, et al., bioRxiv - Cancer Biology 2021

  Quote: ... normal mouse IgG (sc-2025, Santa Cruz), and protein G Dynabeads (10004D ...
• Replication Study: RAF inhibitors prime wild-type RAF to activate the MAPK pathway and enhance growth

  Steven Pelech, et al., bioRxiv - Cancer Biology 2021

  Quote: ... HRP-conjugated goat anti-mouse (Santa Cruz Biotechnology ...
• Wnt/β-catenin inhibition disrupts drug-tolerance in isogenic carboplatin-resistant models of Triple-Negative Breast Cancer

  Willy Antoni Abreu de Oliveira, et al., bioRxiv - Cancer Biology 2021

  Quote: ... mouse anti-β-actin (Santa Cruz, #47778).
• Fbxo45 binds SPRY motifs in the extracellular domain of N-cadherin and regulates neuron migration during brain development

  Youn Na, et al., bioRxiv - Cell Biology 2020

  Quote: ... mouse anti-tubulin (Santa Cruz Biotechnology, Inc.), mouse anti-T7 (EMD Millipore) ...
• LRRK2-phosphorylated Rab10 sequesters Myosin Va with RILPL2 during ciliogenesis blockade

  Izumi Yanatori, et al., bioRxiv - Cell Biology 2020

  Quote: ... mouse anti-CEP164 (1:1000, Santa Cruz); rabbit anti-CP110 (1:2000 ...
• Near-atomic structures of the BBSome reveal a novel mechanism for transition zone crossing

  Kriti Bahl, et al., bioRxiv - Cell Biology 2020

  Quote: ... cMyc (mouse, 9E10, Santa Cruz sc-40), acetylated tubulin (mouse ...
• LINE-1 ORF1p RIP-seq reveals widespread association with p-body enriched mRNAs

  Erica M. Briggs, et al., bioRxiv - Cell Biology 2020

  Quote: ... or mouse IgG (Santa Cruz sc-2025) antibody per 50μl of magnetic beads ...
• Inhibition of the SHP-1 activity by PKC-θ regulates NK cell activation threshold and cytotoxicity

  Aviad Ben-Shmuel, et al., bioRxiv - Immunology 2021

  Quote: ... and Mouse anti-PKC-θ (Santa Cruz). Secondary antibodies ...
• Aerobic glycolysis supports hepatitis B virus biosynthesis through interaction between viral surface antigen and pyruvate kinase isoform M2

  Yi-Hsuan Wu, et al., bioRxiv - Microbiology 2020

  Quote: ... mouse anti-HSC70 (sc-7298, Santa Cruz), rabbit anti-SNAP-tag (P9310 ...
• Shigella sonnei O-antigen inhibits internalisation, vacuole escape and inflammasome activation

  Jayne L Watson, et al., bioRxiv - Microbiology 2019

  Quote: ... mouse anti-caspase-4 (Santa Cruz biotechnology), goat anti-hIL1β (R and D systems) ...
• miRNA profiling of primate cervicovaginal lavage and extracellular vesicles reveals miR-186-5p as a potential retroviral restriction factor in macrophages

  Zezhou Zhao, et al., bioRxiv - Molecular Biology 2019

  Quote: ... and mouse monoclonal IgG_2b CD81 (Santa Cruz Biotechnology ...
• A critical role for Musashi in photoreceptor morphogenesis and Vision

  Jesse Sundar, et al., bioRxiv - Developmental Biology 2020

  Quote: ... mouse anti-Ttc8 (1:1000; Santa Cruz Biotechnology Cat# sc-271009 ...