Labshake search
Citations for Santa Cruz :
351 - 400 of 7406 citations for Rat Epithelial Discoidin Domain Containing Receptor 1 DDR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: A stable cell line expressing shRNA directed against TGFBR2 and TFEB were generated by transducing cells with commercially prepared lentiviruses containing three individual shRNA directed against TGFBR2 (sc-36657-v) and TFEB (sc-38509-v) mRNA (Santa Cruz). Cells were cultured in 6-well plates and infected by adding the shRNA lentiviral particles to the culture for 48 hours per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Ready-to-use lentiviral particles containing a vector encoding human or murine CtBP2 shRNA sequences or non-targeting (control) shRNA sequences were purchased from Santa Cruz Biotechnology (Santa Cruz ...
-
bioRxiv - Genetics 2023Quote: Freshly enucleated eyes were fixed in a phosphate-buffered saline (PBS) solution containing 4% paraformaldehyde (PFA, Santa Cruz, Athis-Mons, France) at 4°C for 12 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were incubated with primary antibodies (anti-Vimentin, 1:200 dilution, Abcam; anti-cytokeratin 14, 1:200 dilution, Millipore, USA; anti-STRO-1, 1:100 dilution, Santa Cruz) at 4°C overnight and washed with PBS four times ...
-
bioRxiv - Immunology 2023Quote: ... The membranes then were incubated at 4◦C overnight with the primary antibodies diluted in the blocking buffer (rabbit anti-NLRP3 1:1000, Abcam, ab263899; rabbit anti-Gsdmd 1:1000, Abcam, ab219800; mouse anti-caspase-1 1:1000, Santa Cruz Biotechnology ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-LAMP-1 (Santa Cruz, sc-20011; IB 1:1,000; IF 1:400), HRP-conjugated goat anti-rabbit IgG (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies against HOIL1 (H-1, 1:1,000), GAPDH (6C5, 1:20,000) were from Santa Cruz. Antibodies to phosphorylated IκBα (5A5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HRAS (1:1000, 18295-1-AP; GAPDH (1:20000, sc-32233; Santa Cruz Biotechnology, Inc.) and rabbit antibodies specific for p-Erk1/2 (phospho-p44/42 MAPK ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-LAMP-1 (1D4B) (lysosome-associated membrane protein 1; Santa Cruz sc-19992; 1:500) anti-IBA1 (ionized calcium-binding adapter molecule 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... p53(DO-1) (1:1000, Santa Cruz, sc-126), anti-Drosophila Nmnat (1:3000) ...
-
bioRxiv - Cell Biology 2019Quote: ... ETS-1 (1:1000; Santa Cruz Biotechnology, sc-55581), α-SMA (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... α-IBA-1 (Santa Cruz Biotechnology sc-32725; 1:200), α-TNFα (Santa Cruz Biotechnology sc-52749 ...
-
bioRxiv - Cell Biology 2021Quote: ... α-PARP-1 (Santa Cruz Biotechnology sc-7150; 1:200), α-Caspase 3 (Santa Cruz Biotechnology sc-7148 ...
-
bioRxiv - Cell Biology 2021Quote: ... α-IBA-1 (Santa Cruz Biotechnology sc-32725; 1:50), α-Tubulin β 3 (Tuj1 ...
-
bioRxiv - Bioengineering 2020Quote: ... mouse PCM-1 (1:200, Santa Cruz, sc-398365), α-actinin (1:800 ...
-
bioRxiv - Neuroscience 2020Quote: ... HSP60 (1:500, Santa Cruz Biotechnology, clone H-1), GAPDH (1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-centrin-1 1:500 (Santa Cruz Biotechnology) for one hour at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... PME-1 (Santa Cruz Biotechnology, sc-20086, 1:1000), phospho PDHE1α S300 (Millipore ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-rabbit:HRP (Santa Cruz, 1:5000-1:20,000).
-
bioRxiv - Developmental Biology 2019Quote: ... and mouse-α-Ascl-1 (1:30, Santa Cruz). Antigen retrieval was performed in a citrate buffer prior to incubation with chicken-α-peripherin ...
-
bioRxiv - Microbiology 2021Quote: ... anti-hADAR-1 (1:500 Santa Cruz sc-271854) anti-p-PKR (1:1000 Abcam ab81303 ...
-
bioRxiv - Genetics 2021Quote: ... 1 mM IPTG (Santa Cruz CAS 367-93-1), and 12.5 μg/ml tetracycline (BioBasic TB0504 (NGM-RNAi plates) ...
-
bioRxiv - Cell Biology 2022Quote: ... Tra-1-60 (Santa Cruz, sc-21705; 1:100), SSEA4 (BD Bioscience ...
-
bioRxiv - Pathology 2023Quote: ... and Caveolin-1 (Santa Cruz # sc-53564, 1:1000) were used as loading controls ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-PL-1(Santa Cruz, sc-376436; 1:200) and anti-PTGS2 (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... VCAM-1 (1:500 #sc-13160 Santa Cruz Biotechnology), diluted in 5% bovine serum albumin (BSA ...
-
bioRxiv - Pathology 2023Quote: ... Zo-1 (Santa Cruz Biotech #sc-33725, 1:200), Amylase (Santa Cruz Biotech #sc-46657 ...
-
bioRxiv - Genetics 2024Quote: ... 1 mM IPTG (Santa Cruz CAS 367-93-1), and 12.5 μg/ml tetracycline (BioBasic TB0504 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were lysed in ice-cold RIPA lysis buffer containing protease inhibitors (sc-24948, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and centrifuged at 12,000 rpm for 20 min at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were lysed in ice-cold RIPA lysis buffer containing protease inhibitors (sc-24948, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and centrifuged at 12,000 rpm for 20 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Neuroscience 2021Quote: ... samples containing same protein amount were subjected to immunoprecipitation with rabbit polyclonal antibody against PDE4B (H-56) (#sc-25812, Santa Cruz Biotechnology) coupled to GammaBind Plus Sepharose beads (# 17-0886-02 ...
-
bioRxiv - Neuroscience 2021Quote: ... or control shRNA lentiviral particles-A (sc-108080) directly to the culture medium containing polybrene (sc-134220) (all from Santa Cruz Biotechnology, Santa Cruz). At 24 hours after transfection ...
-
bioRxiv - Systems Biology 2020Quote: ... 0.25×106 cells were resuspended in 200μl of staining buffer containing anti-CD98 antibody (CD98-Alexa680, Santa Cruz Biotechnology, Inc., sc-59145) or respective isotype control (mouse IgG-Alexa680 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Immunology 2020Quote: ... m6 A-modified RNA was eluted twice in 100 mL of MeRIP buffer containing 5 mM m6 A salt (Santa Cruz Biotechnology) for 30 min at 4C with rotation ...
-
bioRxiv - Microbiology 2022Quote: ... Lysates were incubated overnight with RIP immunoprecipitation buffer containing magnetic Protein G beads conjugated with human SFPQ/PSF antibody (sc-271796, Santa Cruz, Cliniscience) or negative control mouse IgG (5415S ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were given fresh medium containing 5 mM [13C5]-4-HV (synthesized by WuXi) or 10 mM unlabeled 4-HV sodium salt (Santa Cruz Biotechnology). Cells were cultured with 4-HV for 6 hours prior to harvest ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-SOX17 (R&D, 1:50) were diluted and YAP 1 (Santa Cruz, 1:50) were diluted in the blocking buffer and incubated for 48 h in the dark at 4°C on a shaker ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used a kit from Santa Cruz technology ...
-
bioRxiv - Microbiology 2019Quote: ... blocked and re-probed with specific Crithidia fasciculata anti-Hsp70 (1:5000, 1 h) (Johnson and Englund, 1998) and secondary chicken anti-rabbit-HRP (1:2000, 1 h) (Santa Cruz, sc-516087). Signal was detected with Clarity™ ECL Blotting Substrate (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by incubation overnight with primary antibodies (1:200, Nucleolin, CST, 145745; 1:400, NPM1, Sigma, B0556; 1:200, Fibrillarin, Abcam, ab4566; RPA194, 1:50, Santa Cruz, sc-48385) at 4 degree or for 1hr at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... for 10 min at RT and then stained with a primary antibody (1:200, Nucleolin, CST, 145745; 1:400, NPM1, Sigma, B0556; 1:200, Fibrillarin, Abcam, ab4566; RPA194, 1:50, Santa Cruz, sc-48385) for 12 h at 4 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Invitrogen 22C5D8 Pgk1 at 1:6,000; Roche 12CA5 HA at 1:2,000; Invitrogen R960-25 V5 at 1:2,000; Santa Cruz 9E10 c-myc at 1:10,000). The membrane was washed in 1x Tris Buffered Saline with Tween-20 (TBST ...
-
bioRxiv - Biochemistry 2022Quote: ... KIT was immunoprecipitated from the supernatant with 6 μg monoclonal anti-KIT antibody (Santa Cruz Biotechnology, no. sc-13508) together with 30 μL protein G PLUS-agarose beads (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-fibromodulin (1:500, 1% casein, sc-33772, Santa Cruz), anti-pSer2448-mTOR (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... anti-human Caspase-1 (Santa Cruz, sc515, 1: 1,000 dilution), anti-human GSGMD (sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rock-1 (1/100, Goat polyclonal; Santa Cruz sc-6056). Secondary antibodies were Alexa Fluor 488-conjugated donkey anti-goat ...
-
bioRxiv - Molecular Biology 2021Quote: ... while Tubulin by Abcam (1:1000) and Lamin B by Santa Cruz (1:1000). The day after ...