Labshake search
Citations for Santa Cruz :
1901 - 1950 of 8093 citations for 1 tert Butoxy 4 methyl 2 nitrobenzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... incubated in secondary antibody for 1 hour at room temperature (donkey-α-rabbit-HRP, Jackson ImmunoResearch #711-035-152, 1:10,000; mouse-α-actin-HRP, Santa Cruz #sc-47778, 1:10,000), washed and coated in Immobilon Western Chemiluminescent HRP Substrate (Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... The higher molecular weight membrane was incubated for 1 hour with HRP-tagged anti-mouse IgG (1:10000 dilution in 1% BSA in TBS-T, Santa Cruz Biotech goat anti-mouse IgG-HRP) at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... The animals were euthanized and underwent transcardial perfusion with ice-cold 0.1 M phosphate buffered saline (PBS, pH 7.4, Quality Biological) followed by 4% paraformaldehyde (PFA, Santa Cruz Biotechnology, in PBS 0.1 M pH 7.4) at USUHS ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBT for an hour followed by 4°C overnight incubation in primary Fos rabbit polyclonal IgG (sc-52; Santa Cruz Biotechnology, Inc. Dallas, Texas, USA) at a concentration of 1:5000 in 1 % NGS/PBT ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were incubated overnight at 4°C in primary antibody mixtures (HIF1α, Biolegend; EZH2, BD Bioscience; ARL13B, ProteinTech; IMPDH2, Abcam; SMO, Santa Cruz; and Gli1, R&D Systems) diluted with 1% BSA/0.3% Triton-X/PBS solution ...
-
bioRxiv - Developmental Biology 2021Quote: Amputated fins were fixed with 4% paraformaldehyde overnight at 4 °C and used for whole-mount immunofluorescence with a rabbit anti-phospho-histone-H3 primary antibody (#SC-8656R; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) to detect proliferative cells or with a chicken anti-GFP antibody (ab13970 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and fixed in 4% PFA in PBS (15-20 min at RT) and processed for ICC using a primary anti-CDKL5 antibody (Santa Cruz Biotechnology, sc-376314; see above). The treatment with 1,6-Hex was omitted in control cultures ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-Histone cluster 1 H3D (clone 6H8, 1 μg/mL, cat. no. sc-134355, Santa Cruz Biotechnology), anti-cytochrome c1 (clone A-5 ...
-
bioRxiv - Bioengineering 2021Quote: ... 1.5mg·mL−1 in 50% glycerol) as well as 1:200 anti-LAMP1 (rat, Santa Cruz, #sc-19992) and anti-rat coupled to Alexa-fluor 647 (donkey anti-rat ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1:500) and HSP90 (mouse monoclonal anti Hsp90, Santa Cruz, Dallas, TX, Cat# sc-13119, 1:10000). HRP-conjugated secondary antibodies used for detection were diluted 1:5000 (HRP-mouse anti rat ...
-
bioRxiv - Microbiology 2020Quote: ... The dilutions of 1:1000 and 1: 500 were used for Arp3 and FHOD1 (Santa Cruz Biotechnology) immunostaining ...
-
bioRxiv - Cell Biology 2021Quote: The following antibodies were used: mouse anti-GFP (IB: 1:1,000; IP: 1: 400, Santa Cruz Biotechnology). Rabbit anti-RFP (IB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies: mouse anti-CIP2A (clone 2G10-3B5; Santa Cruz sc80659, 1:500 IF, 1:1000 IB), rabbit anti-CIP2A (Cell Signalling Technologies #14805 ...
-
bioRxiv - Cell Biology 2022Quote: ... CBP(Cell Signalling #D6C5;1;1000),GCN5L2(Cell Signalling #C26A10; 1:1000),P300(Santa cruz #sc-48343; 1:100) HAT-1(Santa cruz # sc-390562 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-LIMK-1 monoclonal antibody (1:100 dilution, sc-515585, Santa Cruz Biotechnology, Dallas, TX, USA), mouse anti-LIMK-2 monoclonal antibody (1:100 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with goat anti-hypocretin-1/orexin A antibody (1:500, Santa Cruz, sc-8070) and/or rabbit anti-melanin concentrating hormone (MCH ...
-
bioRxiv - Molecular Biology 2024Quote: ... guinea pig anti-ZNF609 (1:1,000),36 mouse anti-INO80E (Santa cruz biotech, sc-515298, 1:1,000), rabbit anti-INO80 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... monoclonal α-VPS35 (sc-374372; 1:1000) and α-RAB5 (sc-46692; 1:500) from Santa Cruz. For western blot involving Drosophila ...
-
bioRxiv - Cancer Biology 2023Quote: ... pan-cytokeratin (AE-1/AE-3 & C11, both 1:50, Novus & Santa Cruz, NBP2-33200AF647 & SC-8018) and Ki-67 (8D5 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1:1000 rabbit anti-zif268 (Egr-1 SC-189; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a dilution solution containing 1% normal donkey serum and 0.3% Triton-X in 0.1M PBS for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1:1000 rabbit anti-zif268 (Egr-1 SC-189; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a dilution solution containing 1% normal donkey serum and 0.3% Triton-X in 0.1M PBS for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and rabbit anti-somatostatin (1:5,000; T-4103, Peninsula Laboratories, 1:1,000; SC-7819, Santa Cruz Biotechnology) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell pellet was resuspended in 1% BSA/ PBS containing LAMP1 antibody (Santa Cruz, H4A3, 1:400) and incubated for 20 min on a rotating wheel in the cold room ...
-
bioRxiv - Molecular Biology 2024Quote: ... re-probed for 1 hour with 1:5000 HRP-conjugated secondary antibodies (donkey anti-goat, Santa Cruz #sc-2020 ...
-
bioRxiv - Neuroscience 2024Quote: The following antibodies were used: Anti-ATN1 (Santa Cruz, Cat. #sc-517594; 1:100 and 1:200), Anti-HA (Cell Signaling ...
-
bioRxiv - Molecular Biology 2024Quote: ... Primary antibodies (anti-FITC, 1:2000, A889, Invitrogen and Anti-Cy3, 1:2000, sc-166894, Santa Cruz) were diluted in 5% Blocking One solution and incubated 1 hour at RT ...
-
bioRxiv - Immunology 2024Quote: ... primary antibodies (1:500 anti-UIS4 (this paper) plus 1:100 anti-GBP1(Clone G12 Santa Cruz) in 1% BSA-PBS blocking buffer were added and the gels were incubated for 180 min at 37°C on an orbital shaker ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-Vim (Cat# EPR3776, RRID:AB_10562134, 1:500 dilution; Abcam or Cat# sc-373717, RRID:AB_10917747, 1:200 dilution; Santa Cruz), anti-E-cad (Cat# AF648 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in puromycin and/or blasticidin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was incubated on ice for 10 min and super-shift assay was performed by adding 2 µL of anti-HuR antibody (3A2, mouse monoclonal IgG antibody, Santa Cruz Biotechnology). After antibody addition ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was centrifuged to remove debris and the supernatant was rocked at 4°C for 2 h with an anti-Flag antibody (anti-DDDDK tag, MBL Life Science) or mouse anti-IgG antibody (Santa Cruz Biotechnology) that was conjugated with ‘Dynabeads Protein A’ (Veritas ...
-
bioRxiv - Bioengineering 2023Quote: ... Alomone Labs) or 5 µM of antibodies for targeting neurons with dopamine receptor 2 (D2R) (anti-D2DR, sc-5303, Santa Cruz Biotechnology) or without cell type specificity (rabbit anti-human IgG ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cell pellet (corresponding to 2 × 107 cells) was lysed in 500 µL of RIPA Lysis buffer (Santa Cruz Biotechnology, sc-24948) and sonicated to reduce sample viscosity from lysed DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentivirus was harvested at 48 and 72 h after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters before transduction of target cancer cell lines using centrifugation at 1000g for 2 hours in the presence of 8 mg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in 2 μg/mL puromycin and/or 10 μg/mL blasticidin for at least 5 days prior to use in assays ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were probed with primary antibody diluted in 5% skim milk/TBST or 5% Bovine Serum Albumin (BSA)/TBST over night at 4°C: anti-COPA (Santa Cruz Biotechnology, clone H-3, sc-398099), anti-phospho-STAT1 Tyr701 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then frozen at -80°C for later use or applied directly to cells with 4-10 μg/mL polybrene (Santa Cruz Biotechnology, Inc., cat no. SC-134220). The culture media on target plates was changed 24 hours post- transduction.
-
bioRxiv - Cancer Biology 2021Quote: ... 1:3,000), HA-probe (sc-7392, 1:2,000) and vinculin (sc-25336, 1:3,000) were obtained from Santa Cruz Biotechnology ...