Labshake search
Citations for Santa Cruz :
1751 - 1800 of 8766 citations for 7 Quinolinecarboxylicacid 1 2 3 4 tetrahydro 1 methyl 2 oxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Microbiology 2024Quote: ... erythrocytes membrane fractions lysates were incubated for 2 h with 3µg of mouse IgG isotype or mouse immuno-purified anti-HuCK2α (Santa Cruz Biotechnologies). Total lysates (500µg ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg envelope plasmid pMDG encoding VSV-G protein and 1.5 µg lentiviral vector plasmid encoding shRNA to MSI-2 (sc-75834-SH; Santa Cruz Biotechnology). A lentiviral vector plasmid encoding scrambled shRNA sequences with no cellular targets was used as the negative control (sc-108060 ...
-
bioRxiv - Plant Biology 2024Quote: sRNA libraries were constructed using the RealSeq-AC kit version 2 (Realseq Biosciences, Santa Cruz, CA, USA, catalog no. 500-00048;) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... incubated in secondary antibody for 1 hour at room temperature (donkey-α-rabbit-HRP, Jackson ImmunoResearch #711-035-152, 1:10,000; mouse-α-actin-HRP, Santa Cruz #sc-47778, 1:10,000), washed and coated in Immobilon Western Chemiluminescent HRP Substrate (Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... The higher molecular weight membrane was incubated for 1 hour with HRP-tagged anti-mouse IgG (1:10000 dilution in 1% BSA in TBS-T, Santa Cruz Biotech goat anti-mouse IgG-HRP) at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... mouse monoclonal anti-UBA7 (anti-UBE1L B-7; Santa Cruz Biotechnology Cat# sc-390097), rabbit anti-USP18 (Cell Signalling Technology Cat# 4813S) ...
-
bioRxiv - Cell Biology 2021Quote: ... the HA-probe (F-7) mouse monoclonal antibody was used (Santa Cruz, sc-7392). For the detection of ubiquitin ...
-
bioRxiv - Microbiology 2024Quote: ... ELMO1 (B-7) (Cat No sc-271519, Santa Cruz Biotechnology, Santa Cruz, CA, USA) for C1/E1 cells ...
-
bioRxiv - Microbiology 2024Quote: ... ELMO1 (B-7) (Cat No sc-271519, Santa Cruz Biotechnology, Santa Cruz, CA, USA) for C1/E1 cells ...
-
bioRxiv - Developmental Biology 2019Quote: ... pSmad2/3+ cells were stained using a goat anti-pSmad2/3 Ab (sc11769, Santa Cruz) and proliferative cells were stained using a rabbit anti-Ki67 Ab (ab15580 ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-Histone cluster 1 H3D (clone 6H8, 1 μg/mL, cat. no. sc-134355, Santa Cruz Biotechnology), anti-cytochrome c1 (clone A-5 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit and mouse anti FUS (Abcam, ab84078 1:500; and Santa Cruz, sc-47711 1:100 respectively). Images were acquired using either a 710 Laser Scanning Confocal Microscope (Zeiss ...
-
bioRxiv - Molecular Biology 2019Quote: ... α-Trx (1:500; sc-58440), α-NQO1 (1:500, sc-32793) (Santa Cruz Biotechnology, Dallas, TX, USA), α-TrxR1 (1:500 ...
-
bioRxiv - Bioengineering 2021Quote: ... 1.5mg·mL−1 in 50% glycerol) as well as 1:200 anti-LAMP1 (rat, Santa Cruz, #sc-19992) and anti-rat coupled to Alexa-fluor 647 (donkey anti-rat ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1:500) and HSP90 (mouse monoclonal anti Hsp90, Santa Cruz, Dallas, TX, Cat# sc-13119, 1:10000). HRP-conjugated secondary antibodies used for detection were diluted 1:5000 (HRP-mouse anti rat ...
-
bioRxiv - Microbiology 2020Quote: ... The dilutions of 1:1000 and 1: 500 were used for Arp3 and FHOD1 (Santa Cruz Biotechnology) immunostaining ...
-
bioRxiv - Cell Biology 2021Quote: The following antibodies were used: mouse anti-GFP (IB: 1:1,000; IP: 1: 400, Santa Cruz Biotechnology). Rabbit anti-RFP (IB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies: mouse anti-CIP2A (clone 2G10-3B5; Santa Cruz sc80659, 1:500 IF, 1:1000 IB), rabbit anti-CIP2A (Cell Signalling Technologies #14805 ...
-
bioRxiv - Cell Biology 2022Quote: ... CBP(Cell Signalling #D6C5;1;1000),GCN5L2(Cell Signalling #C26A10; 1:1000),P300(Santa cruz #sc-48343; 1:100) HAT-1(Santa cruz # sc-390562 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-LIMK-1 monoclonal antibody (1:100 dilution, sc-515585, Santa Cruz Biotechnology, Dallas, TX, USA), mouse anti-LIMK-2 monoclonal antibody (1:100 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with goat anti-hypocretin-1/orexin A antibody (1:500, Santa Cruz, sc-8070) and/or rabbit anti-melanin concentrating hormone (MCH ...
-
bioRxiv - Cell Biology 2024Quote: ... monoclonal α-VPS35 (sc-374372; 1:1000) and α-RAB5 (sc-46692; 1:500) from Santa Cruz. For western blot involving Drosophila ...
-
bioRxiv - Molecular Biology 2024Quote: ... guinea pig anti-ZNF609 (1:1,000),36 mouse anti-INO80E (Santa cruz biotech, sc-515298, 1:1,000), rabbit anti-INO80 (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell pellet was resuspended in 1% BSA/ PBS containing LAMP1 antibody (Santa Cruz, H4A3, 1:400) and incubated for 20 min on a rotating wheel in the cold room ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1:1000 rabbit anti-zif268 (Egr-1 SC-189; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a dilution solution containing 1% normal donkey serum and 0.3% Triton-X in 0.1M PBS for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1:1000 rabbit anti-zif268 (Egr-1 SC-189; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a dilution solution containing 1% normal donkey serum and 0.3% Triton-X in 0.1M PBS for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and rabbit anti-somatostatin (1:5,000; T-4103, Peninsula Laboratories, 1:1,000; SC-7819, Santa Cruz Biotechnology) antibodies ...
-
bioRxiv - Molecular Biology 2024Quote: ... re-probed for 1 hour with 1:5000 HRP-conjugated secondary antibodies (donkey anti-goat, Santa Cruz #sc-2020 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Oct-4 (Santa Cruz sc-5279 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Genetics 2019Quote: ... Proteins were separated by SDS-PAGE and detected via Western blot following blocking (in TBS-0.1% Tween-20 with 5% non-fat milk powder) with the following antibody dilutions in the same blocking solution: α-GFP-HRP (B-2, sc-9996, Santa Cruz), 1:5000 ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...