Labshake search
Citations for Santa Cruz :
1701 - 1750 of 7988 citations for 3 Methyl 1 6 naphthyridine 2 carboximidamide hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The dilutions of 1:1000 and 1: 500 were used for Arp3 and FHOD1 (Santa Cruz Biotechnology) immunostaining ...
-
bioRxiv - Cell Biology 2021Quote: The following antibodies were used: mouse anti-GFP (IB: 1:1,000; IP: 1: 400, Santa Cruz Biotechnology). Rabbit anti-RFP (IB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies: mouse anti-CIP2A (clone 2G10-3B5; Santa Cruz sc80659, 1:500 IF, 1:1000 IB), rabbit anti-CIP2A (Cell Signalling Technologies #14805 ...
-
bioRxiv - Cell Biology 2022Quote: ... CBP(Cell Signalling #D6C5;1;1000),GCN5L2(Cell Signalling #C26A10; 1:1000),P300(Santa cruz #sc-48343; 1:100) HAT-1(Santa cruz # sc-390562 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-LIMK-1 monoclonal antibody (1:100 dilution, sc-515585, Santa Cruz Biotechnology, Dallas, TX, USA), mouse anti-LIMK-2 monoclonal antibody (1:100 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with goat anti-hypocretin-1/orexin A antibody (1:500, Santa Cruz, sc-8070) and/or rabbit anti-melanin concentrating hormone (MCH ...
-
bioRxiv - Molecular Biology 2024Quote: ... guinea pig anti-ZNF609 (1:1,000),36 mouse anti-INO80E (Santa cruz biotech, sc-515298, 1:1,000), rabbit anti-INO80 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... monoclonal α-VPS35 (sc-374372; 1:1000) and α-RAB5 (sc-46692; 1:500) from Santa Cruz. For western blot involving Drosophila ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1:1000 rabbit anti-zif268 (Egr-1 SC-189; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a dilution solution containing 1% normal donkey serum and 0.3% Triton-X in 0.1M PBS for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1:1000 rabbit anti-zif268 (Egr-1 SC-189; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a dilution solution containing 1% normal donkey serum and 0.3% Triton-X in 0.1M PBS for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and rabbit anti-somatostatin (1:5,000; T-4103, Peninsula Laboratories, 1:1,000; SC-7819, Santa Cruz Biotechnology) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell pellet was resuspended in 1% BSA/ PBS containing LAMP1 antibody (Santa Cruz, H4A3, 1:400) and incubated for 20 min on a rotating wheel in the cold room ...
-
bioRxiv - Molecular Biology 2024Quote: ... re-probed for 1 hour with 1:5000 HRP-conjugated secondary antibodies (donkey anti-goat, Santa Cruz #sc-2020 ...
-
bioRxiv - Neuroscience 2024Quote: The following antibodies were used: Anti-ATN1 (Santa Cruz, Cat. #sc-517594; 1:100 and 1:200), Anti-HA (Cell Signaling ...
-
bioRxiv - Molecular Biology 2024Quote: ... Primary antibodies (anti-FITC, 1:2000, A889, Invitrogen and Anti-Cy3, 1:2000, sc-166894, Santa Cruz) were diluted in 5% Blocking One solution and incubated 1 hour at RT ...
-
bioRxiv - Immunology 2024Quote: ... primary antibodies (1:500 anti-UIS4 (this paper) plus 1:100 anti-GBP1(Clone G12 Santa Cruz) in 1% BSA-PBS blocking buffer were added and the gels were incubated for 180 min at 37°C on an orbital shaker ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-Vim (Cat# EPR3776, RRID:AB_10562134, 1:500 dilution; Abcam or Cat# sc-373717, RRID:AB_10917747, 1:200 dilution; Santa Cruz), anti-E-cad (Cat# AF648 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: anti–pERK1/2 (E-4; sc-7383) and anti– β-actin (C4; sc-47778) from Santa Cruz Biotechnology ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and rotated at 4°C overnight with 2-5 ug of antibody (H3K27ac, Active Motif Cat #39133; V5 tag, ThermoFisher #R960-25; ETV6, Santa Cruz, # sc-166835x ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was separated by centrifugation at 12.000 g at 4 °C for 10 min and incubated with STAT2 antibody (2 µg) (Santa Cruz Biotechnology, 514193) for 3 h at 4°C with gentle shaking ...
-
bioRxiv - Genomics 2023Quote: ... Samples were pre-cleaned by incubating with 2–4 μg of normal immunoglobulin G (IgG) and 50 μl of A / G-agarose protein microspheres (Santa Cruz Biotechnology) for 1 hour at 4 °C with agitation for preclearance ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in puromycin and/or blasticidin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was incubated on ice for 10 min and super-shift assay was performed by adding 2 µL of anti-HuR antibody (3A2, mouse monoclonal IgG antibody, Santa Cruz Biotechnology). After antibody addition ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was centrifuged to remove debris and the supernatant was rocked at 4°C for 2 h with an anti-Flag antibody (anti-DDDDK tag, MBL Life Science) or mouse anti-IgG antibody (Santa Cruz Biotechnology) that was conjugated with ‘Dynabeads Protein A’ (Veritas ...
-
bioRxiv - Bioengineering 2023Quote: ... Alomone Labs) or 5 µM of antibodies for targeting neurons with dopamine receptor 2 (D2R) (anti-D2DR, sc-5303, Santa Cruz Biotechnology) or without cell type specificity (rabbit anti-human IgG ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cell pellet (corresponding to 2 × 107 cells) was lysed in 500 µL of RIPA Lysis buffer (Santa Cruz Biotechnology, sc-24948) and sonicated to reduce sample viscosity from lysed DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentivirus was harvested at 48 and 72 h after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters before transduction of target cancer cell lines using centrifugation at 1000g for 2 hours in the presence of 8 mg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in 2 μg/mL puromycin and/or 10 μg/mL blasticidin for at least 5 days prior to use in assays ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:3,000), HA-probe (sc-7392, 1:2,000) and vinculin (sc-25336, 1:3,000) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... fibroblasts were treated with 1 µM QNZ (EVP4593) or 20 µM TPCA-1 (Santa Cruz and Selleckchem, respectively) for 72 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... EVs (1 μl in 18 μl sterile water) were incubated with CD9 antibody (1 μl; Santa Cruz; #sc9148) for 30 mins at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... The following antibodies were used: anti-PU.1 (Santa Cruz Biotechnology, Santa Cruz, CA; sc-352, 1:500), anti-a-tubulin (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primary antibodies were diluted to 1:50 (MoBu-1 clone mouse anti-BrdU, Santa Cruz Biotechnology, sc-51514), 1:100 (mouse anti-Aurora-B/AIM1 ...
-
bioRxiv - Cell Biology 2021Quote: ... N-terminus (aa 1-175) of human Cdc20 (N-term Ab, 1:300, Santa Cruz Biotechnology, sc-13162), antibody against acetylated M88-terminus of human Cdc20 (M88Ac Ab ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-β-Catenin (eBioscience 14-2567-82, 1:150) and anti-Gata6 (Santa Cruz sc-7244, 1:500). Secondary antibodies conjugated to either Alexa Fluor 488 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies were diluted to 1:50 (MoBu-1 clone mouse anti-BrdU, Santa Cruz Biotechnology, sc-51514), 1:100 (mouse anti-Aurora-B/AIM1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and AIF (Clone E-1) antibody Alexa Fluor® 594 (Santa Cruz, sc-13116, dilution factor 1:400) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies used for immunoblot analyses were: 1:500 – 1:1000 SUMO/Smt3 (y-84; Santa Cruz, sc-28649); 1:3000 GAPDH (Sigma ...