Labshake search
Citations for Santa Cruz :
1451 - 1500 of 2865 citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Oct-4 (Santa Cruz sc-5279 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Primary antibodies were added overnight at 4C in 5% milk powder or 10% roti block (Roth) – 1:1000 Ub antibody P4D4 (Santa Cruz Biotechnology), 1:3000 Hip1 (Proteintech 22231-1AP) ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies were diluted in 2% nonfat dry milk in T-PBS as follows: 1:500 for anti-Cdc42 (Santa Cruz sc-8401); 1:750 for anti-Cdc42 (Santa Cruz sc-87) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Physiology 2020Quote: ... the membranes were washed three times in PBST and incubated 2 h with horseradish peroxidase (HRP) secondary antibodies (1:5000, Santa Cruz Biotechnology). This procedure was followed by three membrane washes with PBST ...
-
bioRxiv - Genetics 2019Quote: ... Proteins were separated by SDS-PAGE and detected via Western blot following blocking (in TBS-0.1% Tween-20 with 5% non-fat milk powder) with the following antibody dilutions in the same blocking solution: α-GFP-HRP (B-2, sc-9996, Santa Cruz), 1:5000 ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated for 2 h at room temperature in the anti-Myc primary antibody A-14 (1:2000 dilution, lot no. F0810; Santa Cruz Biotechnology), rinsed three times with 1X TBST (0.01 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... Membranes were incubated in TBST containing 2% (w/v) BSA with mouse IgG kappa binding protein conjugated to horseradish peroxidase (1:5000) (sc-516102, Santa Cruz Biotechnology) or goat anti-rabbit IgG conjugated to horseradish peroxidase (1:5000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitation was performed by incubating samples in 2 g/mL anti-rabbit (FL-393, sc-6243) or anti-mouse (DO-1, sc-126) P53 antibodies (Santa Cruz Biotechnology) for 2 h at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were fixed with 4% paraformaldehyde for 10 mins at 4°C followed by 30mins blocking with 2% BSA and stained with anti-GLP-1 antibody (1:200) (Gt pAb to GLP-1, SC-26637, Santa Cruz Biotechnology) overnight in a humid chamber at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Biophysics 2022Quote: ... the immunoblots were blocked with 2% BSA and incubated with primary antibodies: Anti-Lamin A/C antibody (E-1) (sc-376248, Santa Cruz Biotechnology) and Anti-Actin antibody ...
-
bioRxiv - Genetics 2022Quote: ... anti-Polycystin-2 (PC2-CT 27, PKD-RCC (https://www.pkd-rrc.org/) and anti-Polycystin-1 (7E12, Santa Cruz cat. no. sc-130554) and secondary labeled antibodies (Licor ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Molecular Biology 2021Quote: K562 cells at 90% confluency were treated for 2 hours with one of the following reagents (1) pladienolide B (Santa Cruz Biotechnology) in DMSO to a final concentration of 10 μM or (2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Slides were then incubated with blocking solution (1% BSA and 10% Donkey serum in freshly prepared 1X PBS) for 2 hrs at RT and then subsequently incubated with primary antibodies: MAP1B at 1:100 (N-19, Santa Cruz Biotechnology), Kif3a at 1:300 (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... seeded at low density and mock-treated or exposed to an increasing dose of UV light (0.5, 1, 2 J/m2 of UV-C 266 nm) or an increasing dose of Illudin S (Santa cruz; sc-391575) for 72 h (15 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells lysates in Tris pH 7.5 50mM and 2% SDS were applied to SDS-PAGE followed by Western blotting using anti-SLC3A2 (Santa Cruz, 1:5000) and anti-ϒ-tubulin antibodies (1:10,000) ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Cancer Biology 2022Quote: ... membranes were incubated overnight at 4 °C with primary antibodies in 0.5% BSA or 2% non-fat milk in T-TBS: anti-AR (1:1000 dilution; Santa Cruz Biotechnology #7305), anti-RUNX1 (1:1000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was then probed with a 1:5,000 dilution of rabbit anti-goat-HRP 2° antibody (Santa Cruz Biotechnology sc-2768), washed ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Microbiology 2024Quote: ... The following primary antibodies used were mouse monoclonal antibody ERK 1/2 (1:1,000 dilution, sc-514302; Santa Cruz Biotechnology, Inc., CA), mouse monoclonal antibody p-ERK 1/2 (1:1,000 dilution ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was incubated on ice for 10 min and super-shift assay was performed by adding 2 µL of anti-HuR antibody (3A2, mouse monoclonal IgG antibody, Santa Cruz Biotechnology). After antibody addition ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in puromycin and/or blasticidin (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Membranes were blocked with TBS containing 1 % casein and 2 % BSA followed by incubation with primary antibodies (survivin 1:2000, 71G4B7, Cell Signaling; beta actin 1:5000 sc-4778, Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2023Quote: ... and lamin A/C N-terminus residues aa 2-29 (LA/C-N, [E-1], sc-376248, Santa Cruz Biotechnology, DA, USA), a rabbit monoclonal Ab (rMAb ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was centrifuged to remove debris and the supernatant was rocked at 4°C for 2 h with an anti-Flag antibody (anti-DDDDK tag, MBL Life Science) or mouse anti-IgG antibody (Santa Cruz Biotechnology) that was conjugated with ‘Dynabeads Protein A’ (Veritas ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cell pellet (corresponding to 2 × 107 cells) was lysed in 500 µL of RIPA Lysis buffer (Santa Cruz Biotechnology, sc-24948) and sonicated to reduce sample viscosity from lysed DNA ...
-
bioRxiv - Immunology 2020Quote: Biopsies were fixed in 4% PFA in PBS (#30525-89-4, Santa Cruz) for 24 hrs at RT and transferred to 70% ethanol ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-toll-like receptor-4 (TLR-4) (Santa Cruz Biotechnology, USA, sc-293072), anti-nuclear factor kappa-B (NFκB ...
-
bioRxiv - Neuroscience 2024Quote: ... fixed overnight at 4°C in 4% paraformaldehyde (Santa Cruz, cat# sc-281692), and dehydrated in 30% sucrose until sectioning ...
-
bioRxiv - Genomics 2021Quote: ... Tubulin was detected using 1:5000 anti-α Tubulin B-7 (sc-5286, Santa Cruz) and 1:2000 of an anti-mouse secondary antibody (sc-2005 ...
-
bioRxiv - Neuroscience 2023Quote: ... Arc was stained with mouse anti-Arc(C-7) (1:400; Santa Cruz, #sc-17839) and visualized with anti-mouse Alexa-488 (1:500 ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-Lamin A/C (4A58) and alpha Tubulin (B-7) were obtained from Santa Cruz Biotechnologies (Dallas ...
-
bioRxiv - Cell Biology 2024Quote: ... Immunoprecipitations were performed using 7 μg of rabbit polyclonal anti-Tgif1 antibody (Santa Cruz Biotechnology) or anti-rabbit ChIP grade IgG (Abcam) ...
-
bioRxiv - Cancer Biology 2020Quote: ... n=10) and were treated with 5 mg/kg isotype specific IgG (IgG1; West Lebanon, New Hampshire) or mAb (Santa Cruz, Dallas, TX) 3 times per week ...
-
bioRxiv - Neuroscience 2022Quote: ... DREADDs-expressing neurons were counterstained for Tacr1 expression with a conjugated Tacr1 antibody (D-11, sc-365091, Santa Cruz Biotechnology, Dallas TX) at 1:50 overnight at 4°C ...
-
bioRxiv - Physiology 2019Quote: ... mouse monoclonal antibody against Gαs (antibody epitope: 11-21 amino acids of human origin, DQRNEEKAQRE, Santa Cruz Biotechnology, Sc-135914, CA, USA), human tubal fluid (HTF ...
-
bioRxiv - Neuroscience 2022Quote: ... Rabbit polyclonal anti-BDNF (N-20 sc-546) and goat polyclonal anti-β actin (C-11 sc-1615) antibodies were purchased from Santa Cruz Biotechnology (Dallas ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... The mouse anti-human SOX18 primary antibody used for immunostaining (E-11) was validated in HemECnaïve and HemECshSOX18 (1:100, Santa Cruz, sc-376166), Cells were co-stained with a rabbit anti-human VE-Cadherin (1:100 ...