Labshake search
Citations for Santa Cruz :
1351 - 1400 of 1595 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Rabbit polyclonal antibodies against SHP2 (sc-280; 1:1000) and mouse monoclonal ERK-2 (D2: sc-1647; 1:1000) were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pfeiffer and Karpas-422 were transduced by spinfection at 1,070 x g (5 acceleration, 2 brake) for 90 min at 37 °C with 8 µg/ml polybrene (Santa Cruz Biotechnology). After 48 h post-transduction ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked with 5% milk/PBS for 2 h before incubation with mouse monoclonal anti-HA antibody (Sc-7392, Santa Cruz) at 1:10,000 for overnight at 4°C ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Pathology 2020Quote: ... HK-2 cells were treated with media containing 5 μg/ml of polybrene (cat. no. sc-134220; Santa Cruz Biotechnology, Inc.), and then LOXL2 shRNA lentiviral particles and control shRNA lentiviral particles of 1 and 2 multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: ... and using α-tubulin as a loading control (mouse anti-α-tubulin B-5-1-2, Santa Cruz Biotechnology, Dallas, TX).
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... The following primary antibodies were used for detection of epitope-tagged proteins: mouse monoclonal anti-GFP clone B-2 (1:1,000, catalog no. sc-9996, Santa Cruz Biotechnology) and anti-RFP antibody (1/2000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were prepared using SDS sample buffer followed by Western Blotting and antibody probing procedures according to the guidelines of the company for the respective antibodies (anti-PPARα: H-2, sc-398394, 1:1000, Santa Cruz Biotechnology ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cbl-b (G-1, sc-8006), anti-ERK2 (D-2, sc-1647) and anti-HSC70 (sc-7298) antibodies were purchased from Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal anti-HA (1:2000; clone F-7) and anti-PCNA (1:2000; clone F-2) antibodies were from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Microbiology 2024Quote: ... erythrocytes membrane fractions lysates were incubated for 2 h with 3µg of mouse IgG isotype or mouse immuno-purified anti-HuCK2α (Santa Cruz Biotechnologies). Total lysates (500µg ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg envelope plasmid pMDG encoding VSV-G protein and 1.5 µg lentiviral vector plasmid encoding shRNA to MSI-2 (sc-75834-SH; Santa Cruz Biotechnology). A lentiviral vector plasmid encoding scrambled shRNA sequences with no cellular targets was used as the negative control (sc-108060 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lysates were cleared by centrifugation at 13000rpm for 15min at 4°C and extracts of equal amount of total protein were used to immunoprecipitated p53 using 2 μg of antibody (DO-1, Santa Cruz) and 20 μL of protein A magnetic beads (prewashed with lysis buffer ...
-
bioRxiv - Plant Biology 2024Quote: sRNA libraries were constructed using the RealSeq-AC kit version 2 (Realseq Biosciences, Santa Cruz, CA, USA, catalog no. 500-00048;) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Coverslips were blocked with 2% goat serum before overnight incubation with primary antibody at 4°C [anti-Rad51 (1:500, Santa Cruz), anti-53BP1 (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... NPC were infected at 80% confluency by adding virus stocks at a final dilution of 1:2 together with 4 µg/mL Polybrene (Santa Cruz), followed by spinning down of virus onto the NPC at 2300 rpm for 1 hour at 30°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... in primary cultured ex vivo cells as well as SKOV3 and SKOV3R using 2’,7’-dichlorofluorescein dihydroacetate (DCFH-DA; Santa Cruz) as per laboratory protocol [20] ...
-
bioRxiv - Immunology 2021Quote: ... SDS-PAGE in Tris-glycine-SDS running buffer and immunoblotting followed standard techniques using the following antibodies: mouse monoclonal anti-ISG15 F-9 (Santa Cruz Biotechnology Cat# sc166755), rabbit polyclonal anti-ISG15 H-150 (Santa Cruz Biotechnology Cat# sc50366) ...
-
bioRxiv - Immunology 2020Quote: ... SDS-PAGE in Tris-glycine-SDS running buffer and immunoblotting followed standard techniques using the following antibodies: mouse monoclonal anti-ISG15 F-9 (Santa Cruz Biotechnology Cat# sc166755), rabbit polyclonal anti-MxA (Proteintech Cat# 13750-1-AP) ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-DKK1 (R&D systems #AF1096 and Santa Cruz #sc-374574), anti-p-JNK (Cell Signaling #4668) ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-EGFR (Santa Cruz Biotechnology # SC-101, clone R-1), anti-WBP2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-Sigma-1 R (1:500; SC-137075 - Santa Cruz Biotechnology), anti-actin (1:2000 ...
-
bioRxiv - Immunology 2023Quote: ... anti-human ASC (1:1,000, sc-22514-R, Santa Cruz biotechnology), anti-ASC (1:1,000 ...
-
bioRxiv - Genetics 2023Quote: ... rabbit anti-pH3 (#SC-8656-R Santa Cruz Biotechnology 1:100), rabbit anti-HIM-3 (Kind gift from Monique Zetka) ...
-
bioRxiv - Immunology 2024Quote: ... rabbit anti-mouse-CD19 (0.2mg/mL: sc-8500-R, Santa Cruz), rat anti-mouse-CD21/CD35 (0.5mg/mL ...
-
bioRxiv - Biochemistry 2020Quote: ... 4-oxo-5-hexenoic acid was obtained from Santa Cruz Biotechnology and succinylphosphonic acid was from MedChem Express ...
-
bioRxiv - Biochemistry 2020Quote: ... and Tri-galacturonic acid (T) (Santa Cruz Biotechnology, Dallas, USA) were used as standards (21).
-
bioRxiv - Neuroscience 2022Quote: ... MSMA (Monosodium acid methane arsonate sesquihydrate) obtained from Santa Cruz biotechnology ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... deoxycholic acid (ChemCruz, Santa Cruz Biotechnology Inc., Dallas TX, USA), lithocholic acid (Cayman Chemical Company ...
-
bioRxiv - Genetics 2023Quote: ... All-trans-retinoic acid (ATRA) was purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies were diluted in 2% nonfat dry milk in T-PBS as follows: 1:500 for anti-Cdc42 (Santa Cruz sc-8401); 1:750 for anti-Cdc42 (Santa Cruz sc-87) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Physiology 2020Quote: ... the membranes were washed three times in PBST and incubated 2 h with horseradish peroxidase (HRP) secondary antibodies (1:5000, Santa Cruz Biotechnology). This procedure was followed by three membrane washes with PBST ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated for 2 h at room temperature in the anti-Myc primary antibody A-14 (1:2000 dilution, lot no. F0810; Santa Cruz Biotechnology), rinsed three times with 1X TBST (0.01 M Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitation was performed by incubating samples in 2 g/mL anti-rabbit (FL-393, sc-6243) or anti-mouse (DO-1, sc-126) P53 antibodies (Santa Cruz Biotechnology) for 2 h at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were fixed with 4% paraformaldehyde for 10 mins at 4°C followed by 30mins blocking with 2% BSA and stained with anti-GLP-1 antibody (1:200) (Gt pAb to GLP-1, SC-26637, Santa Cruz Biotechnology) overnight in a humid chamber at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...