Labshake search
Citations for Santa Cruz :
1351 - 1400 of 5112 citations for Coiled Coil Domain Containing 28B CCDC28B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... milk powder and probed with the relevant primary antibodies: P4D1 horseradish peroxidase (HRP) conjugate anti-Ub antibody was used (Santa cruz; Cat # Sc-8017 HRP) at 1:1000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... were incubated for 45 min at rt using a rabbit polyclonal antibody (pAb) anti-ACE2 (Abcan ref # ab15348) and a mouse monoclonal antibody (mAb) anti-TMPRSS2 (Santa Cruz Biotechnology, Inc. ref # sc-515727). Followed by 30 min incubation at rt with a goat anti-rabbit IgG (goat anti-rabbit IgG ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were incubated in primary antibodies for c-FOS (1:1000, rabbit anti-c-FOS polyclonal antibody, product #sc-52, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and for VGluT2 (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were antibody stained with primary antibodies (anti-53BP1, Santa Cruz Biotechnology sc-22760; anti-FANCD2, Novus Biologicals NB100-182; anti-BLM, Santa Cruz Biotechnology sc-7790) and secondary antibodies (anti-rabbit Alexa Fluor 594 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were lysed in ice-cold RIPA lysis buffer containing protease inhibitors (sc-24948, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and centrifuged at 12,000 rpm for 20 min at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were lysed in ice-cold RIPA lysis buffer containing protease inhibitors (sc-24948, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and centrifuged at 12,000 rpm for 20 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was washed three-times with TBST (TBS containing 0.1% Tween-20) and incubated with HRP-conjugated mouse IgG kappa binding protein (1:5000; Santa Cruz Biotechnology, USA) for 2 hrs at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231-LM2 cells were seeded at a density of 250,000 cells/6-well or 1×106 cells/10 cm dish in D10f medium containing 5 μM CC-401 (Santa Cruz Biotechnology) or 0.1 % DMSO as a vehicle ...
-
bioRxiv - Neuroscience 2021Quote: ... or control shRNA lentiviral particles-A (sc-108080) directly to the culture medium containing polybrene (sc-134220) (all from Santa Cruz Biotechnology, Santa Cruz). At 24 hours after transfection ...
-
bioRxiv - Microbiology 2019Quote: ... Membranes were incubated in TBST containing 2% (w/v) BSA with mouse IgG kappa binding protein conjugated to horseradish peroxidase (1:5000) (sc-516102, Santa Cruz Biotechnology) or goat anti-rabbit IgG conjugated to horseradish peroxidase (1:5000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Afterwards medium was changed and after additional 24 h the medium was changed to selection medium containing 1 µg/mL puromycin (Puromycin dihydrochloride, sc-108071B, Santa Cruz Biotechnology) and after the second transduction also 125 µg/mL hygromycin (Hygromycin B ...
-
bioRxiv - Microbiology 2020Quote: ... Fractions obtained from the ODG were diluted with 8 ml of PBS containing 1 × EDTA-free protease inhibitor cocktail (Santa Cruz, USA), and concentrated using a 10 kDa spin concentrator to remove the excess Optiprep® solution.
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Immunology 2020Quote: ... m6 A-modified RNA was eluted twice in 100 mL of MeRIP buffer containing 5 mM m6 A salt (Santa Cruz Biotechnology) for 30 min at 4C with rotation ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were blocked in 5% milk-PBST and incubated with 1% milk-PBST containing rabbit anti-Grb7 (C-20, Santa Cruz sc606), anti-β-galactosidase (Invitrogen A11132) ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were given fresh medium containing 5 mM [13C5]-4-HV (synthesized by WuXi) or 10 mM unlabeled 4-HV sodium salt (Santa Cruz Biotechnology). Cells were cultured with 4-HV for 6 hours prior to harvest ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Physiology 2021Quote: ... incubated with mouse anti-β-actin antibody (Santa Cruz Biotechnology, 2008), and then detected.
-
bioRxiv - Plant Biology 2020Quote: ... and α-c-Myc Antibody (9E10): sc-40 (Santa Cruz Biotechnology) monoclonal primary antibodies ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-Myc antibody (#SC-40, Santa Cruz; clone 9E10, hybridoma supernatant), anti-GFP antibody (#A-11122 ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-HA antibody (clone 3F10, Sigma Aldrich; #SC-57592, Santa Cruz), anti-Myc antibody (#SC-40 ...
-
bioRxiv - Systems Biology 2020Quote: ... anti-RhoA antibody (Santa Cruz Biotechnology 26C4, sc-418, 1μg/ml), anti-GAPDH (CST D16H11 XP® ...
-
bioRxiv - Cell Biology 2020Quote: ... and immunoblotted with antibodies to Bbs5 (1:200; Santa Cruz Biotechnology), phospho-Bbs5-pSer19 /nonphospho-Bbs5-Ser19 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Dhh antibodies (Santa Cruz Biotechnology, Inc, Cat#sc-271168), rabbit anti-Ptch1 antibodies (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-Smo antibodies (Santa Cruz Biotechnology, Cat# sc-166685) respectively.
-
bioRxiv - Cell Biology 2020Quote: ... or mouse anti-Smo antibodies (Santa Cruz Biotechnology, Cat# sc-166685).
-
bioRxiv - Cell Biology 2020Quote: The following antibodies were used: αTMED2 (Santa Cruz Biotechnology, sc-376459), αTMED10 (sc-137003) ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-Rab 11A antibody (A-6: sc-166912, Santa Cruz Biotech), Anti-acetyl-alpha-tubulin antibody (D20G3 ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-Nrf2 antibody (rabbit, sc-722, Santa Cruz Biotechnology, Inc., USA), anti-phospho-Nrf2 (Ser40 ...
-
bioRxiv - Cell Biology 2020Quote: Primary antibodies: Rabbit anti-Strumpellin (Santa Cruz #sc-87442, 1:500), Rabbit anti-WASH1 c-terminal (Sigma #SAB4200373 ...
-
bioRxiv - Cell Biology 2020Quote: ... For the anti-goat Lamin B Antibody (Santa Cruz, 1:500) a single immunostaining was performed with a donkey anti-goat secondary antibody and Alexa-568 phalloidin ...
-
bioRxiv - Microbiology 2021Quote: ... and C4b detection was determined by monoclonal antibody (Santa Cruz Biotechnology). Dose-dependent inhibition was performed using a 12-point ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubated with secondary antibody FITC donkey anti-goat (Santa Cruz Biotechnology) or Alexa Fluor-555 donkey anti-rabbit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... 5 μg of TAL1 antibody (Santa Cruz Biotechnology, sc12984x, lot B2511) or 5 μL of CTCF antiserum (MilliporeSigma ...
-
bioRxiv - Pathology 2022Quote: ... mouse monoclonal anti-XO antibody (Santa Cruz Biotechnology, Inc., #sc-398548), rabbit polyclonal anti-XO antibody (Abcam ...
-
bioRxiv - Developmental Biology 2022Quote: ... and monoclonal antibody against GST (Cat#sc-138, Santa Cruz Biotechnology) were first concentrated to 2 mg/mL with Amicon Ultra-0.5 mL centrifugal filters before injection (Cat#UFC501024 ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody was from Santa Cruz Biotechnology (#sc-32233).
-
bioRxiv - Molecular Biology 2020Quote: ... or ApoE antibody (1:500, Santa Cruz, San Francisco, CA, USA). Next ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tissue sections were stained with anti-HDAC5 antibody (Santa Cruz Biotechnology) and cell nuclei were detected by 4′,6-diamidino-2-phenylindole (DAPI) ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies used were anti-β-Catenin (Santa Cruz #sc-7963), anti-acethylated Tubulin (Sigma #T7451) ...
-
bioRxiv - Genomics 2020Quote: ... and beta-actin antibodies (Santa Cruz Biotech, Cat# sc-47778 HRP).
-
bioRxiv - Neuroscience 2020Quote: ... The primary antibody raised against DMT1 was purchased from Santa Cruz Biotechnology (CA ...
-
bioRxiv - Genomics 2020Quote: ... Cells were stained with BrdU primary antibody (Santa Cruz, sc-32323) in 3% BSA and incubated overnight in 4°C ...
-
bioRxiv - Genomics 2020Quote: ... mouse anti-Myc antibody (Santa Cruz, sc-40, for western blotting), and mouse anti-Cas9 (Cell Signaling ...
-
bioRxiv - Genomics 2020Quote: ... 2μg Oct-1 antibody (Santa Cruz Biotechnology, Dallas, TX, sc-232) was added and incubated for another 20 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of anti-EGFR antibody (sc-101; Santa Cruz Biotechnology) or anti-EphA2 antibody (#6347 ...
-
bioRxiv - Immunology 2021Quote: ... Anti-IRF7 antibodies (H-246) and (AHP1180) were from Santa Cruz Biotechnology Inc and Bio-Rad Laboratories Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Anti-Rpb1 y-80 antibody (Santa Cruz Biotechnology, sc-25758) in parallel ...
-
bioRxiv - Cell Biology 2019Quote: ... and immunoblotted with primary antibodies against MyoD (Santa Cruz, SC-760) and β-tubulin (Santa Cruz ...