Labshake search
Citations for Santa Cruz :
1351 - 1400 of 1446 citations for 4 Nitro n propan 2 yl aniline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... in primary cultured ex vivo cells as well as SKOV3 and SKOV3R using 2’,7’-dichlorofluorescein dihydroacetate (DCFH-DA; Santa Cruz) as per laboratory protocol [20] ...
-
bioRxiv - Neuroscience 2020Quote: ... The animals were euthanized and underwent transcardial perfusion with ice-cold 0.1 M phosphate buffered saline (PBS, pH 7.4, Quality Biological) followed by 4% paraformaldehyde (PFA, Santa Cruz Biotechnology, in PBS 0.1 M pH 7.4) at USUHS ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBT for an hour followed by 4°C overnight incubation in primary Fos rabbit polyclonal IgG (sc-52; Santa Cruz Biotechnology, Inc. Dallas, Texas, USA) at a concentration of 1:5000 in 1 % NGS/PBT ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were incubated overnight at 4°C in primary antibody mixtures (HIF1α, Biolegend; EZH2, BD Bioscience; ARL13B, ProteinTech; IMPDH2, Abcam; SMO, Santa Cruz; and Gli1, R&D Systems) diluted with 1% BSA/0.3% Triton-X/PBS solution ...
-
bioRxiv - Microbiology 2020Quote: ... α-ISP1 (8), α-SAG1, α-Ty, α-MIC2, ROP2-4 (gifts from J-F Dubremetz, Montpellier) and acetylated α-tubulin (6-11B-1; Santa Cruz Biotechnology). Tubulin antibodies AA344 scFv-S11B (β-tubulin ...
-
bioRxiv - Developmental Biology 2021Quote: Amputated fins were fixed with 4% paraformaldehyde overnight at 4 °C and used for whole-mount immunofluorescence with a rabbit anti-phospho-histone-H3 primary antibody (#SC-8656R; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) to detect proliferative cells or with a chicken anti-GFP antibody (ab13970 ...
-
bioRxiv - Microbiology 2024Quote: ... containing 10% milk for one hour and then incubated overnight at 4°C with anti-PARP-1 mouse monoclonal antibody C2-10 (Santa Cruz Biotechnologies sc-53643, 1/500) or a rabbit polyclonal IgG (Santa Cruz Biotechnologies sc-7150 1/1000) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and fixed in 4% PFA in PBS (15-20 min at RT) and processed for ICC using a primary anti-CDKL5 antibody (Santa Cruz Biotechnology, sc-376314; see above). The treatment with 1,6-Hex was omitted in control cultures ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies were diluted in 2% nonfat dry milk in T-PBS as follows: 1:500 for anti-Cdc42 (Santa Cruz sc-8401); 1:750 for anti-Cdc42 (Santa Cruz sc-87) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Physiology 2020Quote: ... the membranes were washed three times in PBST and incubated 2 h with horseradish peroxidase (HRP) secondary antibodies (1:5000, Santa Cruz Biotechnology). This procedure was followed by three membrane washes with PBST ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated for 2 h at room temperature in the anti-Myc primary antibody A-14 (1:2000 dilution, lot no. F0810; Santa Cruz Biotechnology), rinsed three times with 1X TBST (0.01 M Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitation was performed by incubating samples in 2 g/mL anti-rabbit (FL-393, sc-6243) or anti-mouse (DO-1, sc-126) P53 antibodies (Santa Cruz Biotechnology) for 2 h at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were fixed with 4% paraformaldehyde for 10 mins at 4°C followed by 30mins blocking with 2% BSA and stained with anti-GLP-1 antibody (1:200) (Gt pAb to GLP-1, SC-26637, Santa Cruz Biotechnology) overnight in a humid chamber at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... 80% confluent HEK293-T cells were transfected with 2 μg of TCR plasmid and 1 μg pCL-Eco helper plasmid with 6 μg (3× DNA mass) PEI (Santa Cruz Biotech) to create retrovirus ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Biophysics 2022Quote: ... the immunoblots were blocked with 2% BSA and incubated with primary antibodies: Anti-Lamin A/C antibody (E-1) (sc-376248, Santa Cruz Biotechnology) and Anti-Actin antibody ...
-
bioRxiv - Genetics 2022Quote: ... anti-Polycystin-2 (PC2-CT 27, PKD-RCC (https://www.pkd-rrc.org/) and anti-Polycystin-1 (7E12, Santa Cruz cat. no. sc-130554) and secondary labeled antibodies (Licor ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Molecular Biology 2021Quote: K562 cells at 90% confluency were treated for 2 hours with one of the following reagents (1) pladienolide B (Santa Cruz Biotechnology) in DMSO to a final concentration of 10 μM or (2 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 5 % nonfat dry milk for 2 h at room temperature and then incubated with anti-NaK-ATPase (1:2500; Santa Cruz Biotechnology), anti-LAMP-1 (1:2500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells lysates in Tris pH 7.5 50mM and 2% SDS were applied to SDS-PAGE followed by Western blotting using anti-SLC3A2 (Santa Cruz, 1:5000) and anti-ϒ-tubulin antibodies (1:10,000) ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Cancer Biology 2022Quote: ... membranes were incubated overnight at 4 °C with primary antibodies in 0.5% BSA or 2% non-fat milk in T-TBS: anti-AR (1:1000 dilution; Santa Cruz Biotechnology #7305), anti-RUNX1 (1:1000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Microbiology 2024Quote: ... The following primary antibodies used were mouse monoclonal antibody ERK 1/2 (1:1,000 dilution, sc-514302; Santa Cruz Biotechnology, Inc., CA), mouse monoclonal antibody p-ERK 1/2 (1:1,000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... Membranes were blocked with TBS containing 1 % casein and 2 % BSA followed by incubation with primary antibodies (survivin 1:2000, 71G4B7, Cell Signaling; beta actin 1:5000 sc-4778, Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in puromycin and/or blasticidin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was incubated on ice for 10 min and super-shift assay was performed by adding 2 µL of anti-HuR antibody (3A2, mouse monoclonal IgG antibody, Santa Cruz Biotechnology). After antibody addition ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was centrifuged to remove debris and the supernatant was rocked at 4°C for 2 h with an anti-Flag antibody (anti-DDDDK tag, MBL Life Science) or mouse anti-IgG antibody (Santa Cruz Biotechnology) that was conjugated with ‘Dynabeads Protein A’ (Veritas ...
-
bioRxiv - Bioengineering 2023Quote: ... Alomone Labs) or 5 µM of antibodies for targeting neurons with dopamine receptor 2 (D2R) (anti-D2DR, sc-5303, Santa Cruz Biotechnology) or without cell type specificity (rabbit anti-human IgG ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cell pellet (corresponding to 2 × 107 cells) was lysed in 500 µL of RIPA Lysis buffer (Santa Cruz Biotechnology, sc-24948) and sonicated to reduce sample viscosity from lysed DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentivirus was harvested at 48 and 72 h after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters before transduction of target cancer cell lines using centrifugation at 1000g for 2 hours in the presence of 8 mg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in 2 μg/mL puromycin and/or 10 μg/mL blasticidin for at least 5 days prior to use in assays ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were probed with primary antibody diluted in 5% skim milk/TBST or 5% Bovine Serum Albumin (BSA)/TBST over night at 4°C: anti-COPA (Santa Cruz Biotechnology, clone H-3, sc-398099), anti-phospho-STAT1 Tyr701 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 % TritonTM X-100 in PBS at room temperature) and then incubated overnight with the primary antibody (4° C, rabbit anti-cFos, Santa Cruz Biotechnology, Inc., sc-52, 1:500) in carrier solution (1 % Bovine serum albumin ...
-
bioRxiv - Genomics 2021Quote: ... for 1 hour at room temperature (RT) before incubating overnight at 4°C with the primary antibody for c-Myc (Santa Cruz Biotechnology sc-40, Dallas, Texas USA).Secondary goat anti-rabbit antibody (1:10000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then frozen at -80°C for later use or applied directly to cells with 4-10 μg/mL polybrene (Santa Cruz Biotechnology, Inc., cat no. SC-134220). The culture media on target plates was changed 24 hours post- transduction.
-
bioRxiv - Microbiology 2024Quote: ... containing 4% nonfat milk for 1 hr at room temperature and probed with primary antibodies: 1) anti-HA-probe (Santa Cruz Biotechnology, Cat# sc-7392, 1:500), 2 ...
-
bioRxiv - Biochemistry 2024Quote: ... the membranes were blocked with 5% milk in TBS containing 0.1% tween (TBS-t) and incubated overnight at 4°C with the primary antibodies: Vinculin (Santa Cruz Biotechnology, Cat No. sc-73614, 1:500) and FLAG M2 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were incubated with primary antibodies at 4°C over-night or for 1 h at room temperature at the following dilutions: α-tubulin (sc-32293, Santa Cruz, 1:5000 in 5% milk, mouse), anti-cofilin (gift from Anna Marie Sokac ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein extracts were incubated with each antibody with rotation for 2 hr and then added to protein A/G agarose beads (Santa Cruz, sc-2003) for an additional 1 hr ...