Labshake search
Citations for Santa Cruz :
1351 - 1400 of 1482 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were prepared using SDS sample buffer followed by Western Blotting and antibody probing procedures according to the guidelines of the company for the respective antibodies (anti-PPARα: H-2, sc-398394, 1:1000, Santa Cruz Biotechnology ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cbl-b (G-1, sc-8006), anti-ERK2 (D-2, sc-1647) and anti-HSC70 (sc-7298) antibodies were purchased from Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal anti-HA (1:2000; clone F-7) and anti-PCNA (1:2000; clone F-2) antibodies were from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2024Quote: ... erythrocytes membrane fractions lysates were incubated for 2 h with 3µg of mouse IgG isotype or mouse immuno-purified anti-HuCK2α (Santa Cruz Biotechnologies). Total lysates (500µg ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg envelope plasmid pMDG encoding VSV-G protein and 1.5 µg lentiviral vector plasmid encoding shRNA to MSI-2 (sc-75834-SH; Santa Cruz Biotechnology). A lentiviral vector plasmid encoding scrambled shRNA sequences with no cellular targets was used as the negative control (sc-108060 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lysates were cleared by centrifugation at 13000rpm for 15min at 4°C and extracts of equal amount of total protein were used to immunoprecipitated p53 using 2 μg of antibody (DO-1, Santa Cruz) and 20 μL of protein A magnetic beads (prewashed with lysis buffer ...
-
bioRxiv - Plant Biology 2024Quote: sRNA libraries were constructed using the RealSeq-AC kit version 2 (Realseq Biosciences, Santa Cruz, CA, USA, catalog no. 500-00048;) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Coverslips were blocked with 2% goat serum before overnight incubation with primary antibody at 4°C [anti-Rad51 (1:500, Santa Cruz), anti-53BP1 (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... NPC were infected at 80% confluency by adding virus stocks at a final dilution of 1:2 together with 4 µg/mL Polybrene (Santa Cruz), followed by spinning down of virus onto the NPC at 2300 rpm for 1 hour at 30°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... in primary cultured ex vivo cells as well as SKOV3 and SKOV3R using 2’,7’-dichlorofluorescein dihydroacetate (DCFH-DA; Santa Cruz) as per laboratory protocol [20] ...
-
bioRxiv - Immunology 2022Quote: ... Next the membranes were washed for 5 min X 4 times with PBST and incubated with HRP-conjugated secondary antibodies (Santa Cruz Biotechnology, SantaCruz, CA) for 1 hour ...
-
bioRxiv - Bioengineering 2020Quote: ... Samples were stained overnight with the following primary antibodies diluted 1:100 in 5% BSA in PBS at 4C: anti-MUC2 (Santa Cruz Biotechnology sc-15334), anti-ZO-1 (Santa Cruz Biotechnology sc-33725) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (1/500 dilution in 5% nonfat free milk in TBST buffer; Santa Cruz Biotechnology, Dallas, TX) at room temperature for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were blocked overnight with 5% BSA in PBST at 4 °C and then incubated with 1:50 RAD51 primary antibody (sc-8349, Santa Cruz or ab63801, Abcam) in 2.5% BSA in PBST for 1 hour at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in 5% (v/v) goat serum in PBS and incubated with an antibody recognising the extracellular domain of EGFR (Santa Cruz, Cat# sc-101). This was followed by permeabilization as described above and incubation with an antibody recognising the C-terminus of EGFR (Santa Cruz ...
-
PVT1, a YAP1 dependent stress responsive lncRNA drives ovarian cancer metastasis and chemoresistancebioRxiv - Cancer Biology 2022Quote: ... All cell lines were grown at 37°C in a humidified incubator containing 5% CO2 and Antibodies: monoclonal mouse anti-YAP1 (Santa Cruz Biotechnology, sc-101199), Alexa Fluor 488 goat anti-mouse IgG ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated for 16 hours at 37°C in 5% CO2 then fixed in 4% paraformaldehyde in PBS pH 7.4 (Santa Cruz, Cat. No. sc-281692) with 10 μg/ml of Hoechst (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... followed by incubation with a rabbit polyclonal anti-VP1 antibody (Ma, et al., 2020) or anti-guanylate binding protein (GBP) 1–5 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). After washing ...
-
bioRxiv - Genetics 2023Quote: After permeabilization and intercalator or enzymatic treatment the samples were incubated with 500 μl 5% (m/v) Blotto Non-Fat Dry Milk (Santa Cruz Biotechnology Inc., Santa Cruz, California, USA) in 1×PBS/EDTA for 30 minutes on ice to decrease nonspecific binding of the antibodies ...
-
bioRxiv - Cell Biology 2023Quote: After salt or intercalator treatment the samples were incubated with 500 μl 5% (m/v) Blotto Non-Fat Dry Milk (Santa Cruz Biotechnology Inc., Santa Cruz, California, USA) in PBS/EDTA for 30 minutes on ice ...
-
bioRxiv - Neuroscience 2022Quote: ... The retinas were fixed in 4% PFA for 45 minutes at room temperature and then incubated in 5% normal donkey serum (Jackson Immuno, C840D36) in 1X phosphate buffer saline (PBS) with azide (Santa Cruz Biotechnology, SC-296028) containing 0.5% Triton X-100 (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then centrifuged for 5 min at 340 x g and resuspended with 200μL of 4% PFA in PBS (Santa Cruz Biotech, cat# sc-281692). All samples were acquired with a MACSQuant Analyzer 10 flow cytometer and analyzed with FloJo software version 10.4.0 (Tree Star) ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were blocked in 5% dried milk/TBS-T buffer and incubated over night with anti-mouse TREX1 antibody (clone C-11, Santa Cruz Biotechnology, Dallas, TX) and and anti-β-tubulin polyclonal antibody (Cell Signaling Technology ...
-
bioRxiv - Plant Biology 2024Quote: ... 5-d-old seedlings were transferred to fresh liquid ½ MS medium with 50 µM Bortezomib (Santa Cruz; CAS 179324-69-7; dissolved in DMSO) or an equivalent volume of DMSO and incubated for 2 hours under control conditions ...
-
bioRxiv - Genetics 2024Quote: ... The membranes were blocked with 5% non-fat milk and immunoblotted with primary antibodies against CFTR (769 from the UNC distribution program) or GAPDH (Santa Cruz Biotechnology, Dallas, TX), followed by appropriate HRP-conjugated secondary antibody (Pierce ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies were diluted in 2% nonfat dry milk in T-PBS as follows: 1:500 for anti-Cdc42 (Santa Cruz sc-8401); 1:750 for anti-Cdc42 (Santa Cruz sc-87) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Physiology 2020Quote: ... the membranes were washed three times in PBST and incubated 2 h with horseradish peroxidase (HRP) secondary antibodies (1:5000, Santa Cruz Biotechnology). This procedure was followed by three membrane washes with PBST ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated for 2 h at room temperature in the anti-Myc primary antibody A-14 (1:2000 dilution, lot no. F0810; Santa Cruz Biotechnology), rinsed three times with 1X TBST (0.01 M Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitation was performed by incubating samples in 2 g/mL anti-rabbit (FL-393, sc-6243) or anti-mouse (DO-1, sc-126) P53 antibodies (Santa Cruz Biotechnology) for 2 h at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were fixed with 4% paraformaldehyde for 10 mins at 4°C followed by 30mins blocking with 2% BSA and stained with anti-GLP-1 antibody (1:200) (Gt pAb to GLP-1, SC-26637, Santa Cruz Biotechnology) overnight in a humid chamber at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Biophysics 2022Quote: ... the immunoblots were blocked with 2% BSA and incubated with primary antibodies: Anti-Lamin A/C antibody (E-1) (sc-376248, Santa Cruz Biotechnology) and Anti-Actin antibody ...
-
bioRxiv - Genetics 2022Quote: ... anti-Polycystin-2 (PC2-CT 27, PKD-RCC (https://www.pkd-rrc.org/) and anti-Polycystin-1 (7E12, Santa Cruz cat. no. sc-130554) and secondary labeled antibodies (Licor ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Neuroscience 2022Quote: ... or 10ng/side of PI3K inhibitor 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002; Santa Cruz Biotechnology, Dallas, TX); or vehicle (50% dimethyl sulfoxide [DMSO] in 0.9% NaCl solution ...
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: anti–pERK1/2 (E-4; sc-7383) and anti– β-actin (C4; sc-47778) from Santa Cruz Biotechnology ...