Labshake search
Citations for Santa Cruz :
1301 - 1350 of 1461 citations for Rat Protein Glutamine Gamma Glutamyltransferase 2 TGM2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal anti-HA (1:2000; clone F-7) and anti-PCNA (1:2000; clone F-2) antibodies were from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were prepared using SDS sample buffer followed by Western Blotting and antibody probing procedures according to the guidelines of the company for the respective antibodies (anti-PPARα: H-2, sc-398394, 1:1000, Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Separated proteins were transferred to a PVDF membrane and the membrane was incubated with antibodies to the HA epitope tag (Santa Cruz Biotechnology, sc-805) and α tubulin (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... heat shock protein 90A/B (HSP90) was detected using a rabbit polyclonal antibody (H-114, 1:2500 dilution, Santa Cruz Biotechnology, Santa Cruz, CA, USA) or glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were incubated with the antibodies for 1h at 4°C on a roller before 80µl Protein G PLUS-Agarose beads (Santa Cruz Biotechnology, Dallas, TX, USA) were added and samples were incubated overnight at 4°C on a roller ...
-
bioRxiv - Neuroscience 2019Quote: ... for 1 hour on a rotator at 4°C and then incubated with 50 μL protein A/G PLUS-Agarose (#sc-2003, Santa Cruz Biotechnology, Dallas, Texas) for 2 hours at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Approximately 300 μg of cell lysate at 1-1.5 mg/ml was then pre-cleaned by rotation incubation with 20 μl 50% Protein A/G PLUS-Agarose (Santa Cruz Biotechnology, Texas, USA) at 4°C for 60 min ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Blots were then washed three times for 15 minutes at 4 °C with 0.05% TBS-Tween and stained for 4 hours with mouse IgG kappa binding protein (m-IgGκ BP) conjugated to Horseradish Peroxidase (HRP) (Santa Cruz Biotech, sc-516102) at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% BSA was used to block the membrane followed by protein detection using primary antibody of 1:1000 dilution such as anti-β actin (C4, SC-47778, mouse monoclonal antibody, Santa Cruz Biotechnology, USA), anti-GFP (B-2 ...
-
bioRxiv - Microbiology 2021Quote: ... followed by incubation with a rabbit polyclonal anti-VP1 antibody (Ma, et al., 2020) or anti-guanylate binding protein (GBP) 1–5 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). After washing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The remained liquids were added with anti-NS1 or -VP2 or -IgG antibodies and incubated at 4°C for 4 h followed by addition of protein A/G PLUS-Agarose (Santa Cruz Biotech, sc-2003) and incubation overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added to each sample and then incubated at 4°C for 4 hours followed by addition of protein A/G PLUS -Agarose (Santa Cruz Biotech, sc-2003) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteins extracts (1.5 mg) of embryos expressing CG11412-myc were incubated with 1 μg of c-Myc antibody (Santa Cruz, sc-40, clone 9E10) for 1 h at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... were immunoprecipitated by incubation with protein A/G magnetic beads (HY-K0202, MCE) and anti-GFP antibody (sc-9996, Santa Cruz Biotechnology; 1:50) at 4 °C overnight with gentle rocking ...
-
bioRxiv - Microbiology 2023Quote: ... and primary antibodies to cellular proteins were used as markers for early endosomes (EEA-1; rabbit polyclonal antibody; Santa Cruz Biotechnology Inc; 1:200), and the trans-Golgi (TGN46 ...
-
bioRxiv - Cell Biology 2023Quote: ... 50 µg of protein extract was incubated at 37°C for 1 hr with the artificial p-nitrocatecholsulfate substrate (Santa Cruz Biotechnology, sc-238927A) and either sodium pyrophosphate (ARSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein were loaded per lane and blots were probed with anti-mGFP antibodies (Santa Cruz Biotech, #sc-9996; 1:2000 dilution), anti-elongation factor 1-α (EF1A ...
-
bioRxiv - Molecular Biology 2024Quote: ... the HIS-tagged AtCFI25a protein bound to GST-AtCFI59 was detected by western blot analysis using an anti-HIS antibody (G18) (sc-804; Santa Cruz Biotechnology, Dallas, USA) at 1:5000 dilution.
-
bioRxiv - Cell Biology 2024Quote: ... raised against aa112-608 of recombinant pORF2 protein as used in a previous study (Glitscher et al., 2021a)) as well as anti-GAPDH (Santa Cruz Biotechnology, 1:2,000) and anti-beta-Actin (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: m6A RNA immunoprecipitation was performed using the Magna RIP Kit (Santa Cruz) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The Chronobiology Kit software program (Stanford Software Systems, Santa Cruz, CA, USA) was used to collect ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies were diluted in 2% nonfat dry milk in T-PBS as follows: 1:500 for anti-Cdc42 (Santa Cruz sc-8401); 1:750 for anti-Cdc42 (Santa Cruz sc-87) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Physiology 2020Quote: ... the membranes were washed three times in PBST and incubated 2 h with horseradish peroxidase (HRP) secondary antibodies (1:5000, Santa Cruz Biotechnology). This procedure was followed by three membrane washes with PBST ...
-
bioRxiv - Genetics 2019Quote: ... Proteins were separated by SDS-PAGE and detected via Western blot following blocking (in TBS-0.1% Tween-20 with 5% non-fat milk powder) with the following antibody dilutions in the same blocking solution: α-GFP-HRP (B-2, sc-9996, Santa Cruz), 1:5000 ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated for 2 h at room temperature in the anti-Myc primary antibody A-14 (1:2000 dilution, lot no. F0810; Santa Cruz Biotechnology), rinsed three times with 1X TBST (0.01 M Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitation was performed by incubating samples in 2 g/mL anti-rabbit (FL-393, sc-6243) or anti-mouse (DO-1, sc-126) P53 antibodies (Santa Cruz Biotechnology) for 2 h at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were fixed with 4% paraformaldehyde for 10 mins at 4°C followed by 30mins blocking with 2% BSA and stained with anti-GLP-1 antibody (1:200) (Gt pAb to GLP-1, SC-26637, Santa Cruz Biotechnology) overnight in a humid chamber at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... 80% confluent HEK293-T cells were transfected with 2 μg of TCR plasmid and 1 μg pCL-Eco helper plasmid with 6 μg (3× DNA mass) PEI (Santa Cruz Biotech) to create retrovirus ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Biophysics 2022Quote: ... the immunoblots were blocked with 2% BSA and incubated with primary antibodies: Anti-Lamin A/C antibody (E-1) (sc-376248, Santa Cruz Biotechnology) and Anti-Actin antibody ...
-
bioRxiv - Genetics 2022Quote: ... anti-Polycystin-2 (PC2-CT 27, PKD-RCC (https://www.pkd-rrc.org/) and anti-Polycystin-1 (7E12, Santa Cruz cat. no. sc-130554) and secondary labeled antibodies (Licor ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Neuroscience 2022Quote: ... or 10ng/side of PI3K inhibitor 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002; Santa Cruz Biotechnology, Dallas, TX); or vehicle (50% dimethyl sulfoxide [DMSO] in 0.9% NaCl solution ...
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: anti–pERK1/2 (E-4; sc-7383) and anti– β-actin (C4; sc-47778) from Santa Cruz Biotechnology ...
-
bioRxiv - Synthetic Biology 2019Quote: ... cells were transduced at varying dilutions of the lentiviral stock (ranging from 1:2 to 1:100) in DMEM + 10% FBS with 8 μg/mL polybrene (Santa Cruz Biotechnologies). Media was refreshed on P19 cells 24 h after transduction ...
-
bioRxiv - Molecular Biology 2021Quote: K562 cells at 90% confluency were treated for 2 hours with one of the following reagents (1) pladienolide B (Santa Cruz Biotechnology) in DMSO to a final concentration of 10 μM or (2 ...