Labshake search
Citations for Santa Cruz :
1201 - 1250 of 1327 citations for 2 Amino 4 bromobenzyl alcohol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... cells were plated in 48-well plates (2×105 cells/well in 600μL) and mixed with polybrene (Santa Cruz Biotechnology, 134220) to a final concentration of 4μg/mL and 100-200μL undiluted lentiviral supernatant ...
-
bioRxiv - Bioengineering 2021Quote: ... Primary antibodies used in this work included paxillin (mouse monoclonal anti-paxillin B-2, Santa Cruz Biotechnology, sc-365379, 1:500) to visualize FA formation and α-smooth muscle actin (α-SMA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Rabbit polyclonal antibodies against SHP2 (sc-280; 1:1000) and mouse monoclonal ERK-2 (D2: sc-1647; 1:1000) were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2020Quote: ... GβL (sc-425272) and SUMO1/2/3 deletion were carried out in striatal cells using CRISPR/Cas-9 tools obtained from Santa Cruz, as described before [46 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pfeiffer and Karpas-422 were transduced by spinfection at 1,070 x g (5 acceleration, 2 brake) for 90 min at 37 °C with 8 µg/ml polybrene (Santa Cruz Biotechnology). After 48 h post-transduction ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked with 5% milk/PBS for 2 h before incubation with mouse monoclonal anti-HA antibody (Sc-7392, Santa Cruz) at 1:10,000 for overnight at 4°C ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Pathology 2020Quote: ... HK-2 cells were treated with media containing 5 μg/ml of polybrene (cat. no. sc-134220; Santa Cruz Biotechnology, Inc.), and then LOXL2 shRNA lentiviral particles and control shRNA lentiviral particles of 1 and 2 multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: ... and using α-tubulin as a loading control (mouse anti-α-tubulin B-5-1-2, Santa Cruz Biotechnology, Dallas, TX).
-
bioRxiv - Immunology 2020Quote: Human T cells (2-5 x 106) were transfected with 3 μg of TERT KO CRISPR/Cas9 plasmid (h) (sc-400316, Santa Cruz) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... The following primary antibodies were used for detection of epitope-tagged proteins: mouse monoclonal anti-GFP clone B-2 (1:1,000, catalog no. sc-9996, Santa Cruz Biotechnology) and anti-RFP antibody (1/2000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were prepared using SDS sample buffer followed by Western Blotting and antibody probing procedures according to the guidelines of the company for the respective antibodies (anti-PPARα: H-2, sc-398394, 1:1000, Santa Cruz Biotechnology ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cbl-b (G-1, sc-8006), anti-ERK2 (D-2, sc-1647) and anti-HSC70 (sc-7298) antibodies were purchased from Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal anti-HA (1:2000; clone F-7) and anti-PCNA (1:2000; clone F-2) antibodies were from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Microbiology 2024Quote: ... erythrocytes membrane fractions lysates were incubated for 2 h with 3µg of mouse IgG isotype or mouse immuno-purified anti-HuCK2α (Santa Cruz Biotechnologies). Total lysates (500µg ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg envelope plasmid pMDG encoding VSV-G protein and 1.5 µg lentiviral vector plasmid encoding shRNA to MSI-2 (sc-75834-SH; Santa Cruz Biotechnology). A lentiviral vector plasmid encoding scrambled shRNA sequences with no cellular targets was used as the negative control (sc-108060 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lysates were cleared by centrifugation at 13000rpm for 15min at 4°C and extracts of equal amount of total protein were used to immunoprecipitated p53 using 2 μg of antibody (DO-1, Santa Cruz) and 20 μL of protein A magnetic beads (prewashed with lysis buffer ...
-
bioRxiv - Plant Biology 2024Quote: sRNA libraries were constructed using the RealSeq-AC kit version 2 (Realseq Biosciences, Santa Cruz, CA, USA, catalog no. 500-00048;) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... in primary cultured ex vivo cells as well as SKOV3 and SKOV3R using 2’,7’-dichlorofluorescein dihydroacetate (DCFH-DA; Santa Cruz) as per laboratory protocol [20] ...
-
bioRxiv - Neuroscience 2020Quote: ... The animals were euthanized and underwent transcardial perfusion with ice-cold 0.1 M phosphate buffered saline (PBS, pH 7.4, Quality Biological) followed by 4% paraformaldehyde (PFA, Santa Cruz Biotechnology, in PBS 0.1 M pH 7.4) at USUHS ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBT for an hour followed by 4°C overnight incubation in primary Fos rabbit polyclonal IgG (sc-52; Santa Cruz Biotechnology, Inc. Dallas, Texas, USA) at a concentration of 1:5000 in 1 % NGS/PBT ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were incubated overnight at 4°C in primary antibody mixtures (HIF1α, Biolegend; EZH2, BD Bioscience; ARL13B, ProteinTech; IMPDH2, Abcam; SMO, Santa Cruz; and Gli1, R&D Systems) diluted with 1% BSA/0.3% Triton-X/PBS solution ...
-
bioRxiv - Microbiology 2020Quote: ... α-ISP1 (8), α-SAG1, α-Ty, α-MIC2, ROP2-4 (gifts from J-F Dubremetz, Montpellier) and acetylated α-tubulin (6-11B-1; Santa Cruz Biotechnology). Tubulin antibodies AA344 scFv-S11B (β-tubulin ...
-
bioRxiv - Developmental Biology 2021Quote: Amputated fins were fixed with 4% paraformaldehyde overnight at 4 °C and used for whole-mount immunofluorescence with a rabbit anti-phospho-histone-H3 primary antibody (#SC-8656R; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) to detect proliferative cells or with a chicken anti-GFP antibody (ab13970 ...
-
bioRxiv - Microbiology 2024Quote: ... containing 10% milk for one hour and then incubated overnight at 4°C with anti-PARP-1 mouse monoclonal antibody C2-10 (Santa Cruz Biotechnologies sc-53643, 1/500) or a rabbit polyclonal IgG (Santa Cruz Biotechnologies sc-7150 1/1000) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and fixed in 4% PFA in PBS (15-20 min at RT) and processed for ICC using a primary anti-CDKL5 antibody (Santa Cruz Biotechnology, sc-376314; see above). The treatment with 1,6-Hex was omitted in control cultures ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies were diluted in 2% nonfat dry milk in T-PBS as follows: 1:500 for anti-Cdc42 (Santa Cruz sc-8401); 1:750 for anti-Cdc42 (Santa Cruz sc-87) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Physiology 2020Quote: ... the membranes were washed three times in PBST and incubated 2 h with horseradish peroxidase (HRP) secondary antibodies (1:5000, Santa Cruz Biotechnology). This procedure was followed by three membrane washes with PBST ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated for 2 h at room temperature in the anti-Myc primary antibody A-14 (1:2000 dilution, lot no. F0810; Santa Cruz Biotechnology), rinsed three times with 1X TBST (0.01 M Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitation was performed by incubating samples in 2 g/mL anti-rabbit (FL-393, sc-6243) or anti-mouse (DO-1, sc-126) P53 antibodies (Santa Cruz Biotechnology) for 2 h at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were fixed with 4% paraformaldehyde for 10 mins at 4°C followed by 30mins blocking with 2% BSA and stained with anti-GLP-1 antibody (1:200) (Gt pAb to GLP-1, SC-26637, Santa Cruz Biotechnology) overnight in a humid chamber at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... 80% confluent HEK293-T cells were transfected with 2 μg of TCR plasmid and 1 μg pCL-Eco helper plasmid with 6 μg (3× DNA mass) PEI (Santa Cruz Biotech) to create retrovirus ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...