Labshake search
Citations for Santa Cruz :
951 - 1000 of 8510 citations for 6 Chloro 2 3 diphenylimidazo 1 2 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... cells were blocked with Duolink blocking buffer for 30 m and incubated for 1 h at 37 °C in the presence of primary antibodies for IMPDH (F-6, sc-166551, Santa Cruz) and CTPS1 (sc-131474 ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed once with 6 ml 1% BSA/PBS and resuspended in PBS containing 10 μg/ml propidium iodide (Santa Cruz) and 100 μg/ml RNase A (Qiagen) ...
-
bioRxiv - Physiology 2023Quote: ... Membranes were blocked for at least 0.5 hour in 3% BSA-PBS and incubated overnight at 4°C with the primary SGLT2 mouse monoclonal antibody (D-6, sc-393350, 1/200 dilution, Santa Cruz). The membranes were incubated with highly adsorbed horseradish peroxidase-conjugated goat anti-mouse IgG (A16078 ...
-
bioRxiv - Neuroscience 2024Quote: ... Peripheral blood was taken by heart puncture and mixed with acid-citrate dextrose solution (6:1, V: V, Santa Cruz Biotechnology) as previously described 28 ...
-
bioRxiv - Molecular Biology 2021Quote: ... then soaking the gel for 2 hr with shaking in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate (Santa Cruz Biotech). The gel was then turned 90° and electrophoresed in the orthogonal direction at 130 V for 60 min in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate ...
-
bioRxiv - Immunology 2019Quote: ... and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS: sc-400769-HDR-2, RIG-I: sc-400812-HDR, both Santa Cruz). The knockout plasmids are a mixture of three plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were plated in 48-well plates (2×105 cells/well in 600μL) and mixed with polybrene (Santa Cruz Biotechnology, 134220) to a final concentration of 4μg/mL and 100-200μL undiluted lentiviral supernatant ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pfeiffer and Karpas-422 were transduced by spinfection at 1,070 x g (5 acceleration, 2 brake) for 90 min at 37 °C with 8 µg/ml polybrene (Santa Cruz Biotechnology). After 48 h post-transduction ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked with 5% milk/PBS for 2 h before incubation with mouse monoclonal anti-HA antibody (Sc-7392, Santa Cruz) at 1:10,000 for overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Respective cells were incubated with anti-c-Myc antibody (9E10, mouse monoclonal, 2 mg/ml; Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h at room temperature ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Pathology 2020Quote: ... HK-2 cells were treated with media containing 5 μg/ml of polybrene (cat. no. sc-134220; Santa Cruz Biotechnology, Inc.), and then LOXL2 shRNA lentiviral particles and control shRNA lentiviral particles of 1 and 2 multiplicity of infection (MOI ...
-
bioRxiv - Genetics 2019Quote: ... then incubated in primary antibody in 1% (w/v) skimmed milk in PBS at the following concentrations for 2-20 h at 4°C (anti-Srs2, Santa Cruz sc-1191 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the mem branes were incubated for 2 h at 37 °C with peroxidase conjugated secondary antibodies against r abbit IgG (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg envelope plasmid pMDG encoding VSV-G protein and 1.5 µg lentiviral vector plasmid encoding shRNA to MSI-2 (sc-75834-SH; Santa Cruz Biotechnology). A lentiviral vector plasmid encoding scrambled shRNA sequences with no cellular targets was used as the negative control (sc-108060 ...
-
bioRxiv - Plant Biology 2024Quote: sRNA libraries were constructed using the RealSeq-AC kit version 2 (Realseq Biosciences, Santa Cruz, CA, USA, catalog no. 500-00048;) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... erythrocytes membrane fractions lysates were incubated for 2 h with 3µg of mouse IgG isotype or mouse immuno-purified anti-HuCK2α (Santa Cruz Biotechnologies). Total lysates (500µg ...
-
bioRxiv - Developmental Biology 2019Quote: ... pSmad2/3+ cells were stained using a goat anti-pSmad2/3 Ab (sc11769, Santa Cruz) and proliferative cells were stained using a rabbit anti-Ki67 Ab (ab15580 ...
-
bioRxiv - Biochemistry 2020Quote: ... mouse anti-Doublecortin (E-6) (sc-271390, Santa Cruz), rabbit anti-Doublecortin (4604 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-NRDC (A-6) (sc-137199; Santa Cruz Biotechnology), or anti-c-Fos antibody (2250 ...
-
bioRxiv - Microbiology 2022Quote: ... mouse-anti p65 (F-6) (Santa Cruz; sc-8008), rabbit anti-eIF2α (Cell Signaling ...
-
bioRxiv - Molecular Biology 2024Quote: ... and HMGCS1 (A-6, sc-166763, Santa Cruz Biotechnology).
-
bioRxiv - Neuroscience 2023Quote: ... migratory neurons (Santa Cruz Biotechnology, sc-271390 (E-6), lot ...
-
bioRxiv - Neuroscience 2021Quote: ... with TBS-T and primary antibodies were detected after incubation (3 h) with either rabbit anti-goat IgG-AP (1:2000) or goat anti-rabbit IgG-AP (1:2000) (Santa Cruz, Dallas, TX, USA). Alkaline phosphatase activity was detected with BCIP/NBT AP-conjugate substrate reaction kit (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2° antibodies IgG-HRP anti-goat sc-2953 and anti-mouse sc-2314 at 1:1000 dilutions were incubated for 1 h in 3% milk (all antibodies through Santa Cruz Biotechnology, Dallas, US), followed by three 15 min washes with TBST ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were probed with primary anti-human nuclear factorkappa B (NF-κB) p65 (c-20) sc-372 (1:200 dilution, Santa Cruz Biotechnology, Palo Alto, CA, USA) overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were incubated with primary anti-M2 mAb14C2 (1:300 in PBS supplemented with 3% BSA, Santa Cruz) for 1h ...
-
bioRxiv - Cancer Biology 2020Quote: ... Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (sc-47724) and p53 (sc-47698) at 1:1000 dilution from Santa Cruz Biotechnology and Twist1 (25465-1-AP ...
-
bioRxiv - Cell Biology 2019Quote: ... against CX3CL1 (1/500 dilution) and revealed using a mouse HRP secondary antibody (Santa Cruz, 3/10,000 dilution).
-
bioRxiv - Genomics 2021Quote: ... then at room temperature for 3 hours with secondary antibody (Santa Cruz Biotechnology, cat. sc-2005, 1:1000). Sections were developed in DAB working solution (Vector Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... The antibodies used were as follows: anti-fibulin-3 antibody (1:200, Santa Cruz, #sc-365224, Dallas, TX), anti-fibulin-3 antibody (1:100 ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231-LM2 cells were seeded at a density of 250,000 cells/6-well or 1×106 cells/10 cm dish in D10f medium containing 5 μM CC-401 (Santa Cruz Biotechnology) or 0.1 % DMSO as a vehicle ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were incubated with 100 nM Pladienolide B (PlaB, Santa Cruz Biotechnology, sc-391691) or 0.01% DMSO (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... mouse monoclonal anti-UBA7 (anti-UBE1L B-7; Santa Cruz Biotechnology Cat# sc-390097), rabbit anti-USP18 (Cell Signalling Technology Cat# 4813S) ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-phosphorylated nuclear factor kappa-B (p-NFκB) (Santa Cruz Biotechnology, USA, sc-101751), anti-Bcl-2-associated X protein (Bax ...
-
bioRxiv - Cancer Biology 2019Quote: ... rabbit c-Src (sc-19) and mouse b-actin (sc-58673) from Santa Cruz Biotechnology ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse monoclonal anti-CD81 (B-11) (sc-166029 Santa Cruz Biotechnology, Dallas, TX, USA), rabbit polyclonal anti-Flotillin-1 (ab41927 ...
-
bioRxiv - Microbiology 2024Quote: ... ELMO1 (B-7) (Cat No sc-271519, Santa Cruz Biotechnology, Santa Cruz, CA, USA) for C1/E1 cells ...
-
bioRxiv - Microbiology 2024Quote: ... ELMO1 (B-7) (Cat No sc-271519, Santa Cruz Biotechnology, Santa Cruz, CA, USA) for C1/E1 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...