Labshake search
Citations for Santa Cruz :
901 - 950 of 8205 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-N-cadherin (1:1000, sc-59887, Santa Cruz), anti-Vimentin (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... N-Ras (1:500, Santa Cruz Biotechnology sc-31).
-
bioRxiv - Molecular Biology 2024Quote: ... N-cadherin (1:200, sc-59987, Santa Cruz, USA), Vimentin (1:200 ...
-
bioRxiv - Pathology 2023Quote: ... anti-N-cadherin (1:1000, sc-59887, Santa Cruz), anti-vimentin (1:1000 ...
-
bioRxiv - Pathology 2023Quote: ... anti-N-cadherin (1:1000, sc-59887, Santa Cruz), anti-vimentin (1:1000 ...
-
bioRxiv - Plant Biology 2020Quote: ... AmericanBio cat# AB01185) with or without appropriate antibiotics (15 μg/mL ammonium glufosinate (Santa Cruz Biotechnology, cat# 77182-82-2) for vectors pB7-HFN and pB7-HFC ...
-
bioRxiv - Neuroscience 2021Quote: ... Sheared chromatin (sonicated to 200–500 bp) from 2 × 106 mouse NSCs was incubated with 4μg of Goat THAP1 (sc-98174, Santa Cruz), 4μg of Rabbit YY1 (sc-98174 ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP and mCherry were probed with either mouse monoclonal anti-GFP antibody conjugated to HRP (B-2, Santa Cruz Biotech) or mouse monoclonal anti-mCherry TrueMAB™ antibody conjugated to HRP (OTI10G6 ...
-
bioRxiv - Cell Biology 2021Quote: ... (2) Quantitative western blot analysis of the complex was performed using a directly labeled 488nM anti-GFP antibody (Santa Cruz). The fluorescence intensity at 488 nm was quantified using an Amersham™ Typhoon Scanner and analyzed with ImageJ ...
-
bioRxiv - Plant Biology 2020Quote: ... AmericanBio cat# AB01185) with or without appropriate antibiotics (15 μg/mL ammonium glufosinate (Santa Cruz Biotechnology, cat# 77182-82-2)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... UMUC1 (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz, sc-400743) using lipofectamine3000 (Thermo fisher scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed in 2% formaldehyde solution by adding equal amount of 4% formaldehyde (Santa Cruz Biotechnology, cat# sc-281692) directly in the culture media and incubated for 20 minutes at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... PLGA-PEG (100 mg) was dissolved in acetonitrile (2 mL) with either edaravone (100 mg; Santa Cruz Biotechnology, Dallas, TX) for Eda-MNPs ...
-
bioRxiv - Biochemistry 2022Quote: ... while actin was labeled with the C-2 mouse mAb (both from Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). As a secondary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Phage lysates were treated for 2 hr at 37°C either with 0.01 M methyl methanesulfonate (MMS) (Santa Cruz Biotechnology) or equal volume of phage buffer (100 μM Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... media was removed and cells incubated with 20 mL of PBS containing 2 mM disuccinimidyl glutarate (DSG) (Santa Cruz Chemical) for 20 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: Commercially available antibodies used for immunofluorescence (IF) and Western Blotting (WB) were as follows: mouse anti-mucin-2 (Santa Cruz, sc-7314 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cultures were split and maintained in complete medium supplemented with 2 µg/mL puromycin (Santa Cruz, catalog #sc-108071) for 7 days ...
-
bioRxiv - Biophysics 2024Quote: ... along with BCM (when used, from a 2.5 g/L stock in DMSO; Santa Cruz Biotechnology, CAS 38129-37-2) using an HP D300e Digital Dispenser (Tecan) ...
-
bioRxiv - Neuroscience 2021Quote: ... the cells were treated with 5 μM coelenterazine-N-AM (Santa Cruz Biotechnology sc-205904) in basic saline solution (BS ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-HSP90 1:2000 (Santa Cruz, Cat. n° SC-13119), anti-GAPDH 1:2000 (Santa Cruz ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-HA 1:500 (Santa Cruz, Cat. n°SC-805), anti-IGF2 1:1000 (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-HSP90 1:2,000 (Santa Cruz, Cat. n° SC-13119), anti-GAPDH 1:2,000 (Santa Cruz ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-GAPDH 1:2,000 (Santa Cruz, Cat. n° SC-365062) and anti-HA 1:500 (Santa Cruz ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Sox10 (goat N-20, 1:250, Santa Cruz Biotechnology). The next day ...
-
bioRxiv - Developmental Biology 2020Quote: ... Myc N (Rabbit 1 in 500 Santa Cruz d46-507), Fibrillarin (Rabbit 1 in 500 Abcam ab5821) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-polyUbiquitin 1:5000 (Santa Cruz, Cat. n° SC-8017), anti-DARPP32 1:1000 (Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-GAPDH 1:2000 (Santa Cruz, Cat. n° SC-365062), anti-HA 1:500 (Santa Cruz ...
-
bioRxiv - Molecular Biology 2023Quote: ... or goat anti-CyclinA (1:100, Santa Cruz, N-15). Then ...
-
bioRxiv - Molecular Biology 2021Quote: ... then soaking the gel for 2 hr with shaking in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate (Santa Cruz Biotech). The gel was then turned 90° and electrophoresed in the orthogonal direction at 130 V for 60 min in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mg protein extract was used for immunoprecipitation and incubated with protein G beads and 4 μg mouse anti-GFP antibody (B-2 #sc-9996, Santa Cruz). Western blotting (Fig ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were plated in 48-well plates (2×105 cells/well in 600μL) and mixed with polybrene (Santa Cruz Biotechnology, 134220) to a final concentration of 4μg/mL and 100-200μL undiluted lentiviral supernatant ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Plant Biology 2024Quote: sRNA libraries were constructed using the RealSeq-AC kit version 2 (Realseq Biosciences, Santa Cruz, CA, USA, catalog no. 500-00048;) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... erythrocytes membrane fractions lysates were incubated for 2 h with 3µg of mouse IgG isotype or mouse immuno-purified anti-HuCK2α (Santa Cruz Biotechnologies). Total lysates (500µg ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg envelope plasmid pMDG encoding VSV-G protein and 1.5 µg lentiviral vector plasmid encoding shRNA to MSI-2 (sc-75834-SH; Santa Cruz Biotechnology). A lentiviral vector plasmid encoding scrambled shRNA sequences with no cellular targets was used as the negative control (sc-108060 ...
-
bioRxiv - Cancer Biology 2024Quote: ... in primary cultured ex vivo cells as well as SKOV3 and SKOV3R using 2’,7’-dichlorofluorescein dihydroacetate (DCFH-DA; Santa Cruz) as per laboratory protocol [20] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The following primary antibodies were used for 1h at RT: VE-cadherin F8 (Santa Cruz, SC-9989, 1:100), ERG (Abcam ...
-
bioRxiv - Physiology 2024Quote: ... cells were stained for 1h at 1:100 with rabbit anti-FXR (H-130; sc-13063, Santa Cruz Biotechnology) followed by staining at 1:250 with goat anti-rabbit-IgG-FITC (Jackson ImmunoResearch ...
-
bioRxiv - Physiology 2024Quote: ... for 1h at room temperature with HRP-conjugated anti-mouse secondary antibody (Santa Cruz, sc-2005, 1/10 000). Between each step ...
-
bioRxiv - Cell Biology 2021Quote: ... was diluted 1:10000 in 5% non-fat dry milk in PBST1X and incubated 1h at RT and subsequently with Goat anti-mouse-HRP (Santa Cruz, Dallas, TX, USA-A1303) diluted 1:1000 in 2% non-fat dry milk in PBST1X 30min RT.
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...