Labshake search
Citations for Santa Cruz :
801 - 850 of 7940 citations for Rat EGF Latrophilin And Seven Transmembrane Domain Containing Protein 1 ELTD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... VCAM-1 (1:500 #sc-13160 Santa Cruz Biotechnology), diluted in 5% bovine serum albumin (BSA ...
-
bioRxiv - Pathology 2023Quote: ... Zo-1 (Santa Cruz Biotech #sc-33725, 1:200), Amylase (Santa Cruz Biotech #sc-46657 ...
-
bioRxiv - Genetics 2024Quote: ... 1 mM IPTG (Santa Cruz CAS 367-93-1), and 12.5 μg/ml tetracycline (BioBasic TB0504 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were lysed in ice-cold RIPA lysis buffer containing protease inhibitors (sc-24948, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and centrifuged at 12,000 rpm for 20 min at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were lysed in ice-cold RIPA lysis buffer containing protease inhibitors (sc-24948, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and centrifuged at 12,000 rpm for 20 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Neuroscience 2021Quote: ... or control shRNA lentiviral particles-A (sc-108080) directly to the culture medium containing polybrene (sc-134220) (all from Santa Cruz Biotechnology, Santa Cruz). At 24 hours after transfection ...
-
bioRxiv - Systems Biology 2020Quote: ... 0.25×106 cells were resuspended in 200μl of staining buffer containing anti-CD98 antibody (CD98-Alexa680, Santa Cruz Biotechnology, Inc., sc-59145) or respective isotype control (mouse IgG-Alexa680 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Immunology 2020Quote: ... m6 A-modified RNA was eluted twice in 100 mL of MeRIP buffer containing 5 mM m6 A salt (Santa Cruz Biotechnology) for 30 min at 4C with rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were given fresh medium containing 5 mM [13C5]-4-HV (synthesized by WuXi) or 10 mM unlabeled 4-HV sodium salt (Santa Cruz Biotechnology). Cells were cultured with 4-HV for 6 hours prior to harvest ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... The protein extracts from each culture were immunoprecipitated with anti-human TIM (H-11) (Santa Cruz Biotechnology) for 1 h at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Co-immunoprecipitation was performed according to the instructions of the Protein A/G PLUS-Agarose (Santa Cruz).
-
bioRxiv - Cancer Biology 2022Quote: ... Digested DNA was incubated with 50 µl of protein A/G agarose beads (Santa Cruz, sc-2003) and 10 ul mouse serum (MP Biomedicals ...
-
bioRxiv - Microbiology 2020Quote: ... Whole cells lysates were precleared with 20μl of protein A/G plus (sc-2003; Santa Cruz Biotechnology) at 4°C for 30minutes ...
-
bioRxiv - Immunology 2019Quote: ... Lysate supernatants were pre-cleared by adding 10 µl of protein A/G agarose beads (Santa Cruz) and rotating samples at 4°C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Coimmunoprecipitation Whole-cell lysates (200µg) were incubated with Protein A/G Plus Agarose (Santa Cruz, SC-2003) and an anti-GLUT4 (SC-53566 ...
-
bioRxiv - Cell Biology 2021Quote: ... whole cell lysate is incubating with antibodies conjugated Protein A/G PLUS-Agarose (Santa Cruz, sc-2003) in RIPA at 4°C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein was visualized with either ECL Horseradish Peroxidase linked anti-rabbit or anti-mouse (Santa Cruz Biotechnology) secondary antibody (diluted 1:10,000 ...
-
bioRxiv - Bioengineering 2020Quote: ... mouse IgG kappa binding protein (m-IgGκ BP) conjugated to CruzFluor™ 555 (sc-516177, Santa Cruz), and (iv ...
-
bioRxiv - Bioengineering 2020Quote: ... mouse IgG kappa binding protein (m-IgGκ BP) conjugated to CruzFluor™ 488 (sc-516176, Santa Cruz), (iii ...
-
bioRxiv - Biochemistry 2022Quote: ... NNMT protein was detected with the use of a specific primary antibody (Santa Cruz Biotechnology, sc-376048); anti-rabbit and anti-mouse secondary antibodies conjugated with horseradish peroxidase (HRP ...
-
bioRxiv - Cancer Biology 2022Quote: ... the supernatants were collected and incubated with the primary antibody and immobilized Protein A/G (Santa Cruz) at 4°C overnight with rotation ...
-
bioRxiv - Neuroscience 2022Quote: ... The supernatants were incubated with primary antibodies and protein A/G agarose (Santa Cruz Biotechnology, sc-2003) for 2 h at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells lysates were incubated with 20 μL of Protein A/G agarose gel (Santa Cruz, sc-2003) and a primary antibody with constant rotation overnight at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: The sources of antibodies against the following proteins were as follows: HA (sc-805) from Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2020Quote: ... Lysates were clarified by centrifugation and pre-cleared with protein-A agarose (Santa Cruz Biotech sc-2001) for 1hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... Lysates were pre-cleared with 20μL of protein A/G plus-conjugated agarose beads (Santa Cruz Biotechnology) and 1μL of normal mouse IgG (Santa Cruz Biotechnology) ...
-
bioRxiv - Neuroscience 2020Quote: ... for 16 h at 4 C followed by binding to Protein A Plus-agarose beads (Santa Cruz) at 4C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... proteins were visualised by western blots using either goat anti-APOBEC1 antibody (Santa Cruz - catalog # sc-11739), rabbit anti-A1CF (Sigma - catalog # HPA037779) ...
-
bioRxiv - Immunology 2020Quote: Primary antibodies against the following proteins or peptides were used: anti β-actin (Santa Cruz, #sc-4778), anti PERK (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... the primary antibody was incubated with protein A/G agarose beads (Santa Cruz Biotechnology, Dallas, TX, USA) at 4°C with mild shaking ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or 100 μM of the protein kinase A (PKA) inhibitor Rp-8-Br-cAMPs (Santa Cruz Biotechnology)81.
-
bioRxiv - Cell Biology 2022Quote: Antibodies directed against the following proteins were used in this study: SLC25A46 (Santa Cruz, G2-SC-515823), MFN2 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2022Quote: Total proteins were prepared from cells using RIPA Buffer with Protease Inhibitor Cocktail (sc24948, Santa Cruz Biotechnology). Protein quantified using the Bradford assay (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were precleared with 25 µL Protein A/G PLUS-agarose (Cat # sc-2003, Santa Cruz Biotechnology) at 4°C for 1 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... and bound phages were detected with anti-major coat protein M13-HRP (Santa Cruz, #sc-53004-HRP) diluted 1:1000 in 100 μL PBS-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysates were pre-cleared of non-specific binders by incubating with Protein G (Santa Cruz Biotechnology) beads and IgG ...
-
bioRxiv - Immunology 2023Quote: Total protein from cells was extracted by lysis in radioimmunoprecipitation assay buffer (Santa Cruz Biotechnology, #sc-24948) with protease inhibitor cocktail (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by HRP-conjugated mouse IgG kappa binding protein (Santa Cruz sc-516102, m-igGκ BP-HRP).
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were blotted on Nitrocellulose membrane (Cytiva) and revealed using following antibodies: mouse anti-AGR2 (Santa Cruz Biotechnology ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by 4hrs incubation with protein G-plus agarose beads (sc-2002, Santa Cruz Biotechnology, California, USA). Beads were then collected ...
-
bioRxiv - Microbiology 2023Quote: ... and the fusion proteins were detected by western blotting with anti-c-myc antibodies (sc40, Santa Cruz).
-
bioRxiv - Developmental Biology 2023Quote: ... Proteins were analyzed by western blotting with GFP antibody (B-2, Santa Cruz Biotechnology® – sc 9996) and GAPDH antibody (Ambion® – AM4300) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Primary antibodies against the following proteins or peptides were used: Anti-β-actin (Santa Cruz; #sc-4778), anti-HA (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... supernatants were incubated with indicated antibodies overnight and protein A/G-agarose beads (Santa Cruz, California,USA) for 2 hours at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Co-IP assay was carried out using protein A/G PLUS-Agarose beads (Santa Cruz, Cat# 2003). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... Rabbit polyclonal anti-HA (sc-805) and protein G+ agarose (sc-2002) were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-SOX17 (R&D, 1:50) were diluted and YAP 1 (Santa Cruz, 1:50) were diluted in the blocking buffer and incubated for 48 h in the dark at 4°C on a shaker ...