Labshake search
Citations for Santa Cruz :
8051 - 8100 of 8121 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2024Quote: ... erythrocytes membrane fractions lysates were incubated for 2 h with 3µg of mouse IgG isotype or mouse immuno-purified anti-HuCK2α (Santa Cruz Biotechnologies). Total lysates (500µg ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg envelope plasmid pMDG encoding VSV-G protein and 1.5 µg lentiviral vector plasmid encoding shRNA to MSI-2 (sc-75834-SH; Santa Cruz Biotechnology). A lentiviral vector plasmid encoding scrambled shRNA sequences with no cellular targets was used as the negative control (sc-108060 ...
-
bioRxiv - Plant Biology 2024Quote: sRNA libraries were constructed using the RealSeq-AC kit version 2 (Realseq Biosciences, Santa Cruz, CA, USA, catalog no. 500-00048;) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... in primary cultured ex vivo cells as well as SKOV3 and SKOV3R using 2’,7’-dichlorofluorescein dihydroacetate (DCFH-DA; Santa Cruz) as per laboratory protocol [20] ...
-
bioRxiv - Immunology 2022Quote: ... Next the membranes were washed for 5 min X 4 times with PBST and incubated with HRP-conjugated secondary antibodies (Santa Cruz Biotechnology, SantaCruz, CA) for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in 5% (v/v) goat serum in PBS and incubated with an antibody recognising the extracellular domain of EGFR (Santa Cruz, Cat# sc-101). This was followed by permeabilization as described above and incubation with an antibody recognising the C-terminus of EGFR (Santa Cruz ...
-
PVT1, a YAP1 dependent stress responsive lncRNA drives ovarian cancer metastasis and chemoresistancebioRxiv - Cancer Biology 2022Quote: ... All cell lines were grown at 37°C in a humidified incubator containing 5% CO2 and Antibodies: monoclonal mouse anti-YAP1 (Santa Cruz Biotechnology, sc-101199), Alexa Fluor 488 goat anti-mouse IgG ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated for 16 hours at 37°C in 5% CO2 then fixed in 4% paraformaldehyde in PBS pH 7.4 (Santa Cruz, Cat. No. sc-281692) with 10 μg/ml of Hoechst (Thermo Scientific ...
-
bioRxiv - Genetics 2023Quote: After permeabilization and intercalator or enzymatic treatment the samples were incubated with 500 μl 5% (m/v) Blotto Non-Fat Dry Milk (Santa Cruz Biotechnology Inc., Santa Cruz, California, USA) in 1×PBS/EDTA for 30 minutes on ice to decrease nonspecific binding of the antibodies ...
-
bioRxiv - Cell Biology 2023Quote: After salt or intercalator treatment the samples were incubated with 500 μl 5% (m/v) Blotto Non-Fat Dry Milk (Santa Cruz Biotechnology Inc., Santa Cruz, California, USA) in PBS/EDTA for 30 minutes on ice ...
-
bioRxiv - Neuroscience 2022Quote: ... The retinas were fixed in 4% PFA for 45 minutes at room temperature and then incubated in 5% normal donkey serum (Jackson Immuno, C840D36) in 1X phosphate buffer saline (PBS) with azide (Santa Cruz Biotechnology, SC-296028) containing 0.5% Triton X-100 (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then centrifuged for 5 min at 340 x g and resuspended with 200μL of 4% PFA in PBS (Santa Cruz Biotech, cat# sc-281692). All samples were acquired with a MACSQuant Analyzer 10 flow cytometer and analyzed with FloJo software version 10.4.0 (Tree Star) ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were blocked in 5% dried milk/TBS-T buffer and incubated over night with anti-mouse TREX1 antibody (clone C-11, Santa Cruz Biotechnology, Dallas, TX) and and anti-β-tubulin polyclonal antibody (Cell Signaling Technology ...
-
bioRxiv - Plant Biology 2024Quote: ... 5-d-old seedlings were transferred to fresh liquid ½ MS medium with 50 µM Bortezomib (Santa Cruz; CAS 179324-69-7; dissolved in DMSO) or an equivalent volume of DMSO and incubated for 2 hours under control conditions ...
-
bioRxiv - Genetics 2024Quote: ... The membranes were blocked with 5% non-fat milk and immunoblotted with primary antibodies against CFTR (769 from the UNC distribution program) or GAPDH (Santa Cruz Biotechnology, Dallas, TX), followed by appropriate HRP-conjugated secondary antibody (Pierce ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: anti–pERK1/2 (E-4; sc-7383) and anti– β-actin (C4; sc-47778) from Santa Cruz Biotechnology ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Genomics 2023Quote: ... Samples were pre-cleaned by incubating with 2–4 μg of normal immunoglobulin G (IgG) and 50 μl of A / G-agarose protein microspheres (Santa Cruz Biotechnology) for 1 hour at 4 °C with agitation for preclearance ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in puromycin and/or blasticidin (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was separated by centrifugation at 12.000 g at 4 °C for 10 min and incubated with STAT2 antibody (2 µg) (Santa Cruz Biotechnology, 514193) for 3 h at 4°C with gentle shaking ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was incubated on ice for 10 min and super-shift assay was performed by adding 2 µL of anti-HuR antibody (3A2, mouse monoclonal IgG antibody, Santa Cruz Biotechnology). After antibody addition ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was centrifuged to remove debris and the supernatant was rocked at 4°C for 2 h with an anti-Flag antibody (anti-DDDDK tag, MBL Life Science) or mouse anti-IgG antibody (Santa Cruz Biotechnology) that was conjugated with ‘Dynabeads Protein A’ (Veritas ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cell pellet (corresponding to 2 × 107 cells) was lysed in 500 µL of RIPA Lysis buffer (Santa Cruz Biotechnology, sc-24948) and sonicated to reduce sample viscosity from lysed DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentivirus was harvested at 48 and 72 h after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters before transduction of target cancer cell lines using centrifugation at 1000g for 2 hours in the presence of 8 mg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in 2 μg/mL puromycin and/or 10 μg/mL blasticidin for at least 5 days prior to use in assays ...
-
bioRxiv - Cell Biology 2021Quote: ... was diluted 1:10000 in 5% non-fat dry milk in PBST1X and incubated 1h at RT and subsequently with Goat anti-mouse-HRP (Santa Cruz, Dallas, TX, USA-A1303) diluted 1:1000 in 2% non-fat dry milk in PBST1X 30min RT.
-
bioRxiv - Cell Biology 2020Quote: ... Oil Red O (OrO) working solution was prepared: OrO stock solution (generated by mixing 0.3g Oil Red O powder, Santa Cruz Biotech. CAS# 1320-06-5) was dissolved into 100ml of 100% isopropanol ...
-
bioRxiv - Cell Biology 2023Quote: ... approximately 0.5-1x105 cells were seeded on coated cover glasses for 30 minutes and then fixed with chilled 4% paraformaldehyde (Santa Cruz Biotechnology, Dallas, TX, USA) for 10 minutes at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... and blocked in 5% milk in TBS-T before incubation overnight with one of the following primary antibodies: anti-p53 (Santa Cruz Biotechnology, Cat# sc-126), anti-RPL22 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... membranes were blocked with 5% milk/TBST for 30 min and incubated with primary antibodies/TBST against proteins of interest: anti-RBM12 (Santa Cruz Biotechnology, Cat. #sc-514258), anti-PKA alpha polyclonal antibody (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein extracts were incubated with each antibody with rotation for 2 hr and then added to protein A/G agarose beads (Santa Cruz, sc-2003) for an additional 1 hr ...
-
bioRxiv - Immunology 2021Quote: ... JUND (D-9, sc-271938), SMAD3 (38-Q, sc-101154), MAX (H-2, sc-8011), and MYC (9E10, sc-40) (all, Santa Cruz Biotechnology, USA) followed by peroxidase-conjugated anti-mouse antibodies (NA931 ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse monoclonal primary antibodies included: anti-CD63 (clone MX-49.129.5, 2 μg/mL, cat. no. sc-5275, Santa Cruz Biotechnology, Dallas, TX, USA), anti-CD81 (clone 1.3.3.22 ...
-
bioRxiv - Molecular Biology 2020Quote: ... were washed with 200 μL HBS (150 mM NaCl, 10 mM HEPES, pH7.5 by KOH) and incubated with 2 μg anti-HA (Santa Cruz, Cat.# sc-7392) or 2 μg rabbit IgG isotype (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... all media was removed from the plate and replaced with 8 ml of 2 µg/ml puromycin (Santa Cruz Biotech cat # sc-108071) L-15 selection media ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cas9-expressing cell lines were infected at a density of 2×105 cells in 1.5 mL media in the presence of 4 μg/mL polybrene (Santa Cruz Biotechnology, SC-134220). sgRNA resistant human ZRSR2 DNA fragment was synthesized by Twist Bioscience and cloned into pRRL.idTomato.