Labshake search
Citations for Santa Cruz :
751 - 800 of 8598 citations for 6 chloro 2 N 2 N diethyl 4 N propan 2 yl 1 3 5 triazine 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... After 48h cells were fixed in 4% paraformaldehyde/PBS and stained with mouse anti-Oct-3/4 (C-10) monoclonal antibody (1:250, Cat.#sc-5279, Santa Cruz). Cells were imaged using Zeiss Axiovert 40 CFL microscope and Oct4 positive cells of all DAPI-stained cells were scored with ImageJ software to determine the best titer ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used at the indicated dilutions: mouse anti-OCT-3/4 (C-10 clone, #sc5279, 1:100) (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by an overnight incubation at 4°C with Rabbit-anti-NANOG (1/800, Cell Signalling, #3580S) and Mouse-anti-OCT3/4 (1/250, Santa Cruz, sc-5279) antibodies diluted in BB supplemented with 0.1% Triton-X ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-Ets-1 (C-4) (1:1000; sc-55581, Santa Cruz), mouse anti-GABP-α (G-1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... monocarboxylate transporter 4 (Santa Cruz Biotechnology, [D-1] sc-376140, 1:50) and vimentin (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2021Quote: ... then soaking the gel for 2 hr with shaking in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate (Santa Cruz Biotech). The gel was then turned 90° and electrophoresed in the orthogonal direction at 130 V for 60 min in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate ...
-
bioRxiv - Immunology 2019Quote: ... and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS: sc-400769-HDR-2, RIG-I: sc-400812-HDR, both Santa Cruz). The knockout plasmids are a mixture of three plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were plated in 48-well plates (2×105 cells/well in 600μL) and mixed with polybrene (Santa Cruz Biotechnology, 134220) to a final concentration of 4μg/mL and 100-200μL undiluted lentiviral supernatant ...
-
bioRxiv - Cell Biology 2019Quote: ... Respective cells were incubated with anti-c-Myc antibody (9E10, mouse monoclonal, 2 mg/ml; Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h at room temperature ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the mem branes were incubated for 2 h at 37 °C with peroxidase conjugated secondary antibodies against r abbit IgG (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... overnight at 4°C: anti-YAP (1:25, Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse-anti-EEA (1:500, G-4, Santa Cruz Biotechnology), rabbit-GAPDH (1:2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-mouse OCT3/4 (Santa Cruz; sc-5297; 1:3,000), anti-rat RPA (Cell signaling ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-RSK (B-4) (Santa Cruz sc-74575; 1:1000) anti-pS6 Ser235/236 (Cell Signaling 4858 ...
-
“Identification of microRNAs regulated by E2F transcription factors in human pluripotent stem cells”bioRxiv - Developmental Biology 2024Quote: ... Anti-OCT-4 (1:1000) primary antibody from Santa Cruz Biotechnology (sc-5279 ...
-
bioRxiv - Cancer Biology 2019Quote: ... dried and blotted overnight in 5% BSA TBS-T at 4 °C using primary antibodies (Abcam anti-SMARCD3: ab171075; Santa Cruz anti-β Actin (C-4): sc-47778 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Oct-4 (Santa Cruz sc-5279 ...
-
bioRxiv - Genomics 2020Quote: ... 5 µg of the following antibodies were used: ɑ-Oct3/4 (Santa Cruz, sc-8628), ɑ-Sox2 (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Genetics 2019Quote: ... Proteins were separated by SDS-PAGE and detected via Western blot following blocking (in TBS-0.1% Tween-20 with 5% non-fat milk powder) with the following antibody dilutions in the same blocking solution: α-GFP-HRP (B-2, sc-9996, Santa Cruz), 1:5000 ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in puromycin and/or blasticidin (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was centrifuged to remove debris and the supernatant was rocked at 4°C for 2 h with an anti-Flag antibody (anti-DDDDK tag, MBL Life Science) or mouse anti-IgG antibody (Santa Cruz Biotechnology) that was conjugated with ‘Dynabeads Protein A’ (Veritas ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was incubated on ice for 10 min and super-shift assay was performed by adding 2 µL of anti-HuR antibody (3A2, mouse monoclonal IgG antibody, Santa Cruz Biotechnology). After antibody addition ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Immunology 2020Quote: Biopsies were fixed in 4% PFA in PBS (#30525-89-4, Santa Cruz) for 24 hrs at RT and transferred to 70% ethanol ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-toll-like receptor-4 (TLR-4) (Santa Cruz Biotechnology, USA, sc-293072), anti-nuclear factor kappa-B (NFκB ...
-
bioRxiv - Neuroscience 2019Quote: ... permeabilized in PBS with 10% triton-x for 30 min and incubated for three days at 4 °C with goat anti-DCX antibody (1:250 in 10% triton-x and 3% horse serum (sc-8066; Santa Cruz Biotechnology, USA). Sections were washed and incubated in biotinylated donkey anti-goat secondary antibody for 60 minutes (1:250 ...
-
bioRxiv - Immunology 2020Quote: ... 1xPBS) and incubated overnight at 4°C using the following dilutions: anti-COPA (1:100, Santa Cruz Biotechnology, clone H-3, sc-398099) and anti-STING (1:100 ...
-
bioRxiv - Genetics 2019Quote: ... USA) for 24 hours at 4°C or rabbit anti glyceraldehyde 3-phosphate dehydrogenase (anti-GAPDH) (1:1000, Santa Cruz, Dallas, TX, USA) for 3 hours at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were diluted 1:5 in RIPA buffer and incubated overnight at 4°C with 1 µg/ml myogenin antibody (Santa Cruz Biotechnology, #sc-12732 X) or IgG1 isotype control (Thermo Fisher ...