Labshake search
Citations for Santa Cruz :
651 - 700 of 814 citations for Rat Vasoactive intestinal polypeptide receptor 2 VIPR2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Phage lysates were treated for 2 hr at 37°C either with 0.01 M methyl methanesulfonate (MMS) (Santa Cruz Biotechnology) or equal volume of phage buffer (100 μM Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... media was removed and cells incubated with 20 mL of PBS containing 2 mM disuccinimidyl glutarate (DSG) (Santa Cruz Chemical) for 20 minutes at room temperature ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were then incubated for 2 h with primary antibody anti-α-Syn sc-69977 (Santa Cruz, 1:100 dilution) in blocking buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immunoblots were visualized by enhanced chemiluminescence (ECL kit, Santa Cruz Biotechnology) after washes ...
-
bioRxiv - Molecular Biology 2021Quote: ... and visualized with a chemoluminescence kit (Santa Cruz Biotechnology, sc-2048) or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies against proliferating cell nuclear antigen (PCNA-1, 1/200, sc-7907, Santa Cruz; PCNA-2, 1/200, M087901, Dako) were applied overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... then soaking the gel for 2 hr with shaking in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate (Santa Cruz Biotech). The gel was then turned 90° and electrophoresed in the orthogonal direction at 130 V for 60 min in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mg protein extract was used for immunoprecipitation and incubated with protein G beads and 4 μg mouse anti-GFP antibody (B-2 #sc-9996, Santa Cruz). Western blotting (Fig ...
-
bioRxiv - Immunology 2019Quote: ... and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS: sc-400769-HDR-2, RIG-I: sc-400812-HDR, both Santa Cruz). The knockout plasmids are a mixture of three plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were plated in 48-well plates (2×105 cells/well in 600μL) and mixed with polybrene (Santa Cruz Biotechnology, 134220) to a final concentration of 4μg/mL and 100-200μL undiluted lentiviral supernatant ...
-
bioRxiv - Bioengineering 2021Quote: ... Primary antibodies used in this work included paxillin (mouse monoclonal anti-paxillin B-2, Santa Cruz Biotechnology, sc-365379, 1:500) to visualize FA formation and α-smooth muscle actin (α-SMA ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then blocked for 1 h in 10% BSA and 2% normal goat serum (NGS) and incubated overnight at 4 °C with primary antibody (ERα, 1:250, sc-8002, Santa Cruz). Following 3 × 10 min washing in PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... Rabbit polyclonal antibodies against SHP2 (sc-280; 1:1000) and mouse monoclonal ERK-2 (D2: sc-1647; 1:1000) were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2020Quote: ... GβL (sc-425272) and SUMO1/2/3 deletion were carried out in striatal cells using CRISPR/Cas-9 tools obtained from Santa Cruz, as described before [46 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pfeiffer and Karpas-422 were transduced by spinfection at 1,070 x g (5 acceleration, 2 brake) for 90 min at 37 °C with 8 µg/ml polybrene (Santa Cruz Biotechnology). After 48 h post-transduction ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked with 5% milk/PBS for 2 h before incubation with mouse monoclonal anti-HA antibody (Sc-7392, Santa Cruz) at 1:10,000 for overnight at 4°C ...
-
bioRxiv - Biophysics 2019Quote: ... MA, USA), phospho Histone H2A.X (D17A3) (Cell Signalling Technology, Danvers, MA, USA) and CD86 B7-2 (GL-1) (Santa Cruz Technologies) combined with Alexa 647 and Alexa 488 conjugated secondary antibodies (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... Respective cells were incubated with anti-c-Myc antibody (9E10, mouse monoclonal, 2 mg/ml; Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1×105 cells were pre-incubated for 1-2 h in N2 medium without antibiotics and 1 μg/μl of polybrene (Santa Cruz) to increase transduction efficiency ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Pathology 2020Quote: ... HK-2 cells were treated with media containing 5 μg/ml of polybrene (cat. no. sc-134220; Santa Cruz Biotechnology, Inc.), and then LOXL2 shRNA lentiviral particles and control shRNA lentiviral particles of 1 and 2 multiplicity of infection (MOI ...
-
bioRxiv - Genetics 2019Quote: ... then incubated in primary antibody in 1% (w/v) skimmed milk in PBS at the following concentrations for 2-20 h at 4°C (anti-Srs2, Santa Cruz sc-1191 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the mem branes were incubated for 2 h at 37 °C with peroxidase conjugated secondary antibodies against r abbit IgG (Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2021Quote: ... and using α-tubulin as a loading control (mouse anti-α-tubulin B-5-1-2, Santa Cruz Biotechnology, Dallas, TX).
-
bioRxiv - Immunology 2020Quote: Human T cells (2-5 x 106) were transfected with 3 μg of TERT KO CRISPR/Cas9 plasmid (h) (sc-400316, Santa Cruz) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cbl-b (G-1, sc-8006), anti-ERK2 (D-2, sc-1647) and anti-HSC70 (sc-7298) antibodies were purchased from Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal anti-HA (1:2000; clone F-7) and anti-PCNA (1:2000; clone F-2) antibodies were from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2022Quote: ... The following primary antibodies were used for detection of epitope-tagged proteins: mouse monoclonal anti-GFP clone B-2 (1:1,000, catalog no. sc-9996, Santa Cruz Biotechnology) and anti-RFP antibody (1/2000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were prepared using SDS sample buffer followed by Western Blotting and antibody probing procedures according to the guidelines of the company for the respective antibodies (anti-PPARα: H-2, sc-398394, 1:1000, Santa Cruz Biotechnology ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: m6A RNA immunoprecipitation was performed using the Magna RIP Kit (Santa Cruz) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The Chronobiology Kit software program (Stanford Software Systems, Santa Cruz, CA, USA) was used to collect ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies were diluted in 2% nonfat dry milk in T-PBS as follows: 1:500 for anti-Cdc42 (Santa Cruz sc-8401); 1:750 for anti-Cdc42 (Santa Cruz sc-87) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Physiology 2020Quote: ... the membranes were washed three times in PBST and incubated 2 h with horseradish peroxidase (HRP) secondary antibodies (1:5000, Santa Cruz Biotechnology). This procedure was followed by three membrane washes with PBST ...
-
bioRxiv - Genetics 2019Quote: ... Proteins were separated by SDS-PAGE and detected via Western blot following blocking (in TBS-0.1% Tween-20 with 5% non-fat milk powder) with the following antibody dilutions in the same blocking solution: α-GFP-HRP (B-2, sc-9996, Santa Cruz), 1:5000 ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated for 2 h at room temperature in the anti-Myc primary antibody A-14 (1:2000 dilution, lot no. F0810; Santa Cruz Biotechnology), rinsed three times with 1X TBST (0.01 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... Membranes were incubated in TBST containing 2% (w/v) BSA with mouse IgG kappa binding protein conjugated to horseradish peroxidase (1:5000) (sc-516102, Santa Cruz Biotechnology) or goat anti-rabbit IgG conjugated to horseradish peroxidase (1:5000 ...