Labshake search
Citations for Santa Cruz :
601 - 650 of 7904 citations for 2 Bromo 1 5 bromofuran 2 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... MOLM-13 and K562 cells were transduced by spinfection at 1,800 × g for 1.5 h at 37 °C with 5 µg mL-1 and 8 µg mL-1 polybrene (Santa Cruz Biotechnology), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... H-8), cul-5 (WB 1:500, H-300), and mouse anti-AMBAR1(G-6, 1:500) were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:10,000) were blocked in 5% milk while those to be probed with GFP (rabbit polyclonal; Santa Cruz, #sc8334; 1:2000) were blocked in Superblock Blocking Buffer (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was blocked with 5% non-fat dry milk in TBS-Tween 1% and incubated with FMRP (1:100 Mouse Santa Cruz) and Actin (1:8000 Rabbit Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: anti–pERK1/2 (E-4; sc-7383) and anti– β-actin (C4; sc-47778) from Santa Cruz Biotechnology ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Genomics 2023Quote: ... Samples were pre-cleaned by incubating with 2–4 μg of normal immunoglobulin G (IgG) and 50 μl of A / G-agarose protein microspheres (Santa Cruz Biotechnology) for 1 hour at 4 °C with agitation for preclearance ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in puromycin and/or blasticidin (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was separated by centrifugation at 12.000 g at 4 °C for 10 min and incubated with STAT2 antibody (2 µg) (Santa Cruz Biotechnology, 514193) for 3 h at 4°C with gentle shaking ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was incubated on ice for 10 min and super-shift assay was performed by adding 2 µL of anti-HuR antibody (3A2, mouse monoclonal IgG antibody, Santa Cruz Biotechnology). After antibody addition ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was centrifuged to remove debris and the supernatant was rocked at 4°C for 2 h with an anti-Flag antibody (anti-DDDDK tag, MBL Life Science) or mouse anti-IgG antibody (Santa Cruz Biotechnology) that was conjugated with ‘Dynabeads Protein A’ (Veritas ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cell pellet (corresponding to 2 × 107 cells) was lysed in 500 µL of RIPA Lysis buffer (Santa Cruz Biotechnology, sc-24948) and sonicated to reduce sample viscosity from lysed DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentivirus was harvested at 48 and 72 h after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters before transduction of target cancer cell lines using centrifugation at 1000g for 2 hours in the presence of 8 mg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in 2 μg/mL puromycin and/or 10 μg/mL blasticidin for at least 5 days prior to use in assays ...
-
bioRxiv - Cancer Biology 2024Quote: ... The membranes were then washed three times with TBS-T (5 min) and incubated with secondary goat anti-rabbit-HRP (sc-2030, Santa Cruz, 1:4,000 in 5% (w/v) milk in TBS-T ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1:50,000), anti-β-catenin (E-5) (sc-7963, 1:1000) and anti-β-actin (C4, sc-47778, 1:50,000) from Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was blocked in 5% non-fat dry milk in PBST for 1 hr and incubated in SMARCAL1 (1:500; sc-376377, Santa Cruz Biotechnology) or tubulin (1:10,000 ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were stained with Anti-YAP in 5% BSA (1:250, mouse, sc-398182, Santa Cruz) primary antibody and incubated for 1 hr at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pre-cleared chromatin was incubated with 5 μg of FRA-1 antibody (Santa Cruz #sc-605) overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Myosin VIIa (1:50 dilution, clone C-5, sc-74516, Santa Cruz Biotechnology Inc.), rat anti-HCAM (CD44 ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-mouse IgG-AP (1:1000 in 5% BSA; #sc-2008; Santa Cruz Biotechnology, Inc.); mouse anti- alpha-tubulin (1:6000 ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: mouse anti- CCDC134 (E-5, Santa Cruz Biotechnology, 1:500); mouse anti-HSP90B1 (H-10 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein extracts were incubated with each antibody with rotation for 2 hr and then added to protein A/G agarose beads (Santa Cruz, sc-2003) for an additional 1 hr ...
-
bioRxiv - Immunology 2021Quote: ... JUND (D-9, sc-271938), SMAD3 (38-Q, sc-101154), MAX (H-2, sc-8011), and MYC (9E10, sc-40) (all, Santa Cruz Biotechnology, USA) followed by peroxidase-conjugated anti-mouse antibodies (NA931 ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse monoclonal primary antibodies included: anti-CD63 (clone MX-49.129.5, 2 μg/mL, cat. no. sc-5275, Santa Cruz Biotechnology, Dallas, TX, USA), anti-CD81 (clone 1.3.3.22 ...
-
bioRxiv - Molecular Biology 2020Quote: ... were washed with 200 μL HBS (150 mM NaCl, 10 mM HEPES, pH7.5 by KOH) and incubated with 2 μg anti-HA (Santa Cruz, Cat.# sc-7392) or 2 μg rabbit IgG isotype (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... all media was removed from the plate and replaced with 8 ml of 2 µg/ml puromycin (Santa Cruz Biotech cat # sc-108071) L-15 selection media ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cas9-expressing cell lines were infected at a density of 2×105 cells in 1.5 mL media in the presence of 4 μg/mL polybrene (Santa Cruz Biotechnology, SC-134220). sgRNA resistant human ZRSR2 DNA fragment was synthesized by Twist Bioscience and cloned into pRRL.idTomato.
-
bioRxiv - Physiology 2021Quote: ... Kidney cortex cryosections were labeled with a polyclonal goat anti-aquaporin-2 (Aqp2) antibody (0.2 μg/ml, sc-9882; Santa Cruz Biotechnology, Santa Cruz CA, USA), and detected using a donkey anti-goat immunoglobulin G conjugated to Cyanine Cy3 (0.5 μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 5% skimmed milk powder for 2 hours at room temperature.Incubate primary antibody overnight at 4°C.The membrane was washed three times with TBST and then incubated at room temperature with conjugated HRP secondary antibodies for 2 hours.ECL (enhanced chemiluminescence kit, Santa Cruz Biotechnology, Dallas, TX) detection system (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... overnight rotating at 4 °C together with either α-KAP1 or α-RIF1 antibodies (see Supplementary Table 2) or IgG only control (#sc-2026, Santa Cruz), 10% of chromatin was isolated as input control ...
-
bioRxiv - Immunology 2020Quote: Recombinant SARS-CoV-2-S1 protein produced in HEK cells (Creative Diagnostics, DAGC091) was covalently labeled using CruzFluor647 (Santa Cruz Biotechnology, sc-362620) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... catalog number sc7392), α-GFP (clone B-2, catalog number sc9996), and α-ubiquitin (clone P4D1, catalog number sc8017) antibodies were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2022Quote: ... iPSCs were passaged as needed in the presence of 2 μM Rho-associated kinase (ROCK) inhibitor (RI) thiazovivin (Santa Cruz Biotechnology, #SC-361380). Prior to transfection ...
-
bioRxiv - Genetics 2022Quote: ... Once the cells were ∼50% confluent (after 2-3 days) the media was changed to StemFlex with 1ug/uL polybrene (Santa Cruz SC-134220), and 10uL each of Ngn2 and rtTA virus was added to each well ...
-
bioRxiv - Cell Biology 2024Quote: ... The sections were blocked and incubated for 2 days at 4°C with the following primary antibodies: mouse anti-MBP (sc-66064, Santa Cruz Biotechnology Inc.), goat anti-OLIG2 (Bio-Techne ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 500 μg of the supernatant proteins were incubated with 2 μg of mouse monoclonal antibody raised against SNAP-25 (Santa Cruz, sc-390814) or Syntaxin1a (MilliporeSigma ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were permeabilized with 0.5% Triton-X 100 and blocked with 1% BSAprior to incubation with primary and secondary antibody (1:100) (Nox1 (Santa Cruz, sc-5821), (LRRC8D (Santa Cruz ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polyclonal total SMAD 1/5/9(8) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, #sc-6031-R) and a polyclonal actin antibody (Santa Cruz Biotechnology ...