Labshake search
Citations for Santa Cruz :
551 - 600 of 7974 citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... 1 μM concanamycin A (conA) (CAS 80890-47-7; Santa Cruz); 50 μM 2,4-dinitrophenol (DNP ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 μM concanamycin A (conA; CAS 80890-47-7; Santa Cruz) was added to the relevant treatment condition and an equal volume of DMSO was added in the control condition ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 µM Concanamycin A (Santa Cruz Biotechnology – CAS 80890-47-7) was added to the new medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... then soaking the gel for 2 hr with shaking in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate (Santa Cruz Biotech). The gel was then turned 90° and electrophoresed in the orthogonal direction at 130 V for 60 min in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mg protein extract was used for immunoprecipitation and incubated with protein G beads and 4 μg mouse anti-GFP antibody (B-2 #sc-9996, Santa Cruz). Western blotting (Fig ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were plated in 48-well plates (2×105 cells/well in 600μL) and mixed with polybrene (Santa Cruz Biotechnology, 134220) to a final concentration of 4μg/mL and 100-200μL undiluted lentiviral supernatant ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pfeiffer and Karpas-422 were transduced by spinfection at 1,070 x g (5 acceleration, 2 brake) for 90 min at 37 °C with 8 µg/ml polybrene (Santa Cruz Biotechnology). After 48 h post-transduction ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked with 5% milk/PBS for 2 h before incubation with mouse monoclonal anti-HA antibody (Sc-7392, Santa Cruz) at 1:10,000 for overnight at 4°C ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Pathology 2020Quote: ... HK-2 cells were treated with media containing 5 μg/ml of polybrene (cat. no. sc-134220; Santa Cruz Biotechnology, Inc.), and then LOXL2 shRNA lentiviral particles and control shRNA lentiviral particles of 1 and 2 multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Plant Biology 2024Quote: sRNA libraries were constructed using the RealSeq-AC kit version 2 (Realseq Biosciences, Santa Cruz, CA, USA, catalog no. 500-00048;) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... erythrocytes membrane fractions lysates were incubated for 2 h with 3µg of mouse IgG isotype or mouse immuno-purified anti-HuCK2α (Santa Cruz Biotechnologies). Total lysates (500µg ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg envelope plasmid pMDG encoding VSV-G protein and 1.5 µg lentiviral vector plasmid encoding shRNA to MSI-2 (sc-75834-SH; Santa Cruz Biotechnology). A lentiviral vector plasmid encoding scrambled shRNA sequences with no cellular targets was used as the negative control (sc-108060 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse α-pan 14-3-3 (sc-1657, Santa Cruz Biotechnology, 1:1000 to 1:10000), α-Flag® M2-HRP (A8592 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse anti-HA (Santa Cruz Biotechnology F-7; Western Blot 1:500), Rabbit anti-Ankyrin-G (Synaptic Systems 386 003 ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIS-1 - mouse monoclonal antibody H-7 (Santa Cruz, sc-374586). All labeled secondary antibodies were obtained from Invitrogen ...
-
Single-cell assessment of trophoblast stem cell-based organoids as human placenta-modeling platformsbioRxiv - Developmental Biology 2022Quote: ... mouse monoclonal anti-cytokeratin 7 (clone RCK105; 1:100; Santa Cruz Biotechnology), rabbit monoclonal anti-EGR1 (1:50 ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-Slug (1:1000, A-7, sc- 166476, Santa Cruz Biotech.), mouse anti-Zeb1 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: anti–pERK1/2 (E-4; sc-7383) and anti– β-actin (C4; sc-47778) from Santa Cruz Biotechnology ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and rotated at 4°C overnight with 2-5 ug of antibody (H3K27ac, Active Motif Cat #39133; V5 tag, ThermoFisher #R960-25; ETV6, Santa Cruz, # sc-166835x ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cell pellets were then incubated with room temperature PBS containing 2 mM DSG (disuccinimidyl glutarate, sc-285455, Santa Cruz Biotechnology) for 25 min with gentle agitation ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was separated by centrifugation at 12.000 g at 4 °C for 10 min and incubated with STAT2 antibody (2 µg) (Santa Cruz Biotechnology, 514193) for 3 h at 4°C with gentle shaking ...
-
bioRxiv - Genomics 2023Quote: ... Samples were pre-cleaned by incubating with 2–4 μg of normal immunoglobulin G (IgG) and 50 μl of A / G-agarose protein microspheres (Santa Cruz Biotechnology) for 1 hour at 4 °C with agitation for preclearance ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology). Transduced cell lines were selected in puromycin and/or blasticidin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was incubated on ice for 10 min and super-shift assay was performed by adding 2 µL of anti-HuR antibody (3A2, mouse monoclonal IgG antibody, Santa Cruz Biotechnology). After antibody addition ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was centrifuged to remove debris and the supernatant was rocked at 4°C for 2 h with an anti-Flag antibody (anti-DDDDK tag, MBL Life Science) or mouse anti-IgG antibody (Santa Cruz Biotechnology) that was conjugated with ‘Dynabeads Protein A’ (Veritas ...
-
bioRxiv - Bioengineering 2023Quote: ... Alomone Labs) or 5 µM of antibodies for targeting neurons with dopamine receptor 2 (D2R) (anti-D2DR, sc-5303, Santa Cruz Biotechnology) or without cell type specificity (rabbit anti-human IgG ...