Labshake search
Citations for Becton, Dickinson and Company :
301 - 331 of 331 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Cells were then permeabilized with BD Fix/Perm for 20 min at room temperature (RT) and stained intracellularly with antibodies in 1x Perm buffer (BD Biosciences): anti-IFN-γ (1:100 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were then incubated with an intracellular antibody panel for 30 min at RT in 1x permeability/wash buffer (BD #554723), including NeuN-APC (1:50) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were harvested and washed with ice-cold PBS twice and resuspended in annexin V binding buffer (#556454 BS bioscience) and incubated at RT in the dark with 7-amino-actinomycin D (7-AAD, #559925, BD bioscience) and annexin-V for 15 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Final PCR products were purified with AMPure Beads (BD Bioscience). The library was prepared with PCR products pooled in equimolar amounts following the manufacture’s protocol and loaded in a Micro MiSeq Reagent Kit v2 (500-cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... Final PCR products were purified with AMPure Beads (BD Bioscience). The library was prepared with PCR products pooled in equimolar amounts following the manufacture’s protocol and loaded in a Micro MiSeq Reagent Kit v2 (500-cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified with AMPure Beads (BD Bioscience, US). For the second (PCR2) ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed in perm/wash solution, followed by intracellular staining (30 min, RT) using a cocktail of the following antibodies: IFN-γ (BD, 557998)/IL-2 (BD ...
-
IL-27R signaling serves as immunological checkpoint for NK cells to promote hepatocellular carcinomabioRxiv - Immunology 2020Quote: ... After washing with 1% BSA-PBS slides were incubated with secondary goat anti-rat and goat anti-rabbit biotinylated antibodies for 30 min at RT followed by 30 min of incubation with streptavidin–HRP (1:500; BD Pharmingen, 554066). For developing DAB substrate (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... Plates were then incubated in the dark at RT for 15 minutes and analyzed via flow cytometry using BC Fortessa device (BD Bioscience, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... and 5% goat serum) for 1h at RT and then stained with EC specific CD31 antibody (BD biosciences, 550274, 1:25 dilution) or muscle base membrane laminin antibody (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Immunology 2022Quote: ... Real-time PCR was performed with the QuantStudio3 System (BD Biosciences) using SYBR Premix Ex Taq II mix (TaKaRa Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were incubated in the dark at RT with 3 μL propidium iodide (Miltenyi Biotech; cat. 130-093-233) and 3 μL FITC-Annexin V (BD Biosciences; cat. 556419) for 20 minutes and then diluted with 100 μL binding buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Secondary antibody incubated for one hour at RT in 5% milk TBS-T at 1:1,000 (HRP-Anti-Mouse, BD Pharmigen, Goat Polycloncal, 554002). Between steps 3 × 5 minute washes were performed in TBST ...
-
bioRxiv - Cancer Biology 2023Quote: ... Correlation of expression data for the 597 genes in the multiomic mRNA panel generated from K562 cells using the original BD Rhapsody reverse transcription procedure (BD RT; n=1,716) or SuperScript IV RT (SSIV RT ...
-
bioRxiv - Physiology 2021Quote: ... A 3% BSA-0.2% Triton®X-100 solution was used for permeabilization and blocking followed by a 1 h RT incubation with PBS–1% BSA containing mouse monoclonal DRP1 antibody (611113, BD Transduction Laboratories, 1:50) followed by a 1 h RT incubation with PBS–1%BSA containing rabbit polyclonal RyR2 (PA5-36121 ...
-
bioRxiv - Physiology 2021Quote: ... The PCR product was cloned into a pIRES2-EGFP expression vector (BD Biosciences Clontech Franklin Lakes ...
-
SIMON, an automated machine learning system reveals immune signatures of influenza vaccine responsesbioRxiv - Immunology 2019Quote: ... Cells were then incubated for 1h at RT (or left at 4°C overnight) in the Iridium-intercalator solution in fixation and permeabilization buffer (BD Cytofix/Cytoperm™, BD Biosciences). Then cells were washed with 1x permeabilization buffer (BD Perm/Wash™ ...
-
bioRxiv - Immunology 2023Quote: ... Final products for library index PCR were diluted with elution buffer (BD Biosciences) into 2 ng/μl of mRNA targeted PCR2 product and 1 ng/μl of sample tag PCR2 product ...
-
bioRxiv - Immunology 2020Quote: ... The cecal content was then homogenized in sterile PBS by vortexing (maximum speed, 5 min., RT) and filtered (BD Falcon™, 40 µm cell strainer # 352340). Larger debris were removed by centrifugation (1000 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... colon and fecal samples were homogenized (5 mg/ml in PBS) by vortexing (maximum speed, 5 min., RT) and filtered (BD Falcon™, 40 μm cell strainer # 352340). Larger debris were pelleted by centrifugation (600 g ...
-
bioRxiv - Biochemistry 2023Quote: PCR reactions were performed with PrimeSTAR MAX DNA Polymerase (BD Clontech GmbH, Heidelberg, Germany) or Phusion High-Fidelity polymerase (Thermo Fisher Scientific GmbH ...
-
bioRxiv - Genetics 2019Quote: ... DNA was amplified by PCR and fragments of inappropriate sizes were removed using Agencourt AMPure XP beads (BD). Finally ...
-
bioRxiv - Genetics 2019Quote: ... DNA was amplified by PCR and fragments of inappropriate sizes were removed using Agencourt AMPure XP beads (BD). Finally ...
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: The coding sequence of MYC2 PCR-amplified from cDNA using PHANTA was fused with GAL4 DNA-binding domain (BD) of the bait vector pGBKT7 (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmid transduction into the above-mentioned yeast strains was confirmed by PCR (KK70/CY179 for AGB1.x-BD, KK281/CY180 for AGG1-AD ...
-
bioRxiv - Neuroscience 2020Quote: ... the isolated cells with fluorescence signals were sorted and enriched directly into 0.2-μl PCR tubes by a FACS machine (BD Influx). Noted that ...
-
bioRxiv - Plant Biology 2022Quote: ... and the PCR products were fused into the activation domain (AD) vector pGADT7 and/or the DNA-binding domain (BD) vector pGBKT7 and verified by sequencing ...
-
bioRxiv - Immunology 2023Quote: ... P33681) without the leader sequence was PCR-amplified and cloned into the pAcGP67 of the BaculoGold Baculovirus Expression System (BD Biosciences). This vector was modified so that all proteins featured a C-terminal H12-tag ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...