Labshake search
Citations for Becton, Dickinson and Company :
301 - 350 of 457 citations for Recombinant Rabbit IL17F Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... HK Mtb or LPS (100 ng/mL) for 24h and the Golgi Plug protein transport inhibitor (BD Biosciences) was added for the last 6h according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... The proteins in the lysates were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (BD Biosciences). The phosphorylation of the ERBBs and ERK was detected on the membranes with anti-pERBB1–B4 and anti-ppERK primary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% penicillin/streptomycin and 10 mM HEPES (pH 7.4) with 25% high-protein Matrigel (product 354248; BD Biosciences)) ...
-
bioRxiv - Genetics 2022Quote: ... Anti-RPA4 (1:4000-1:8000, sheep serum, home made), Anti-Actin Protein Antibody (1:30,000, mouse) (BD Transduction Laboratory ...
-
bioRxiv - Biophysics 2023Quote: ... Flow analysis of the correlation of protein production levels was carried out on a LSR II (BD Bioscience) equipped with 405 nm ...
-
bioRxiv - Immunology 2023Quote: Cytokines were analyzed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Cells from ELISpot plate were collected in media supplemented with GolgiStop Protein Transport Inhibitor (BD Biosciences, NJ, USA) and incubated for 6 hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen or eBioscience were used for flow cytometry: Phycoerythrin (PE) or peridinin chlorophyll protein -cyanine 5.5 (PerCP-Cy5.5)-conjugated CD3 (BD Biosciences Cat#5 61808 ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies used included: C terminal binding protein-2 (mouse anti-CtBP2; BD Transduction Labs, used at 1:200), myosin-VIIA (rabbit anti-myosin-VIIA ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:200) and (2) C-terminal binding protein 2 (mouse anti-CtBP2; BD Biosciences; used at 1:200) with secondary antibodies coupled to Alexa Fluors 647 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... Cytokines were analysed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Note these experiments were carried out using early access kits from BD Genomics before the implementation of commercially-available single-cell protein/RNA assays (e.g. Feature Barcoding, 10x Genomics; BD Abseq ...
-
bioRxiv - Immunology 2021Quote: ... HRP-conjugated anti-mouse IgG (SantaCruz, Cat no. sc-2005) and anti-rabbit IgG (BD Pharmingen, Cat no. 554021) were used as secondary antibodies.
-
bioRxiv - Neuroscience 2024Quote: ... After incubation with appropriate horseradish peroxidase-conjugated secondary antibodies (HRP-linked anti-mouse or anti-rabbit IgG; BD Biosciences) at RT for 1 h ...
-
bioRxiv - Cell Biology 2019Quote: Cells expressing eGFP-tagged huntingtin proteins were harvested and eGFP expression was analyzed on an LSR Fortessa (BD Pharmingen) flow cytometer for PulSA analysis to detect protein aggregates ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were transferred to supported nitrocellulose membrane and probed using Syn101 antibodies against aSyn (BD labs, San Jose, CA). Blots were imaged on using a ChemiDoc MP imager and analyzed using Image Lab (Bio-Rad ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... cells expressing TagRFP-tagged proteins were flow-sorted using a BD Influx cell sorter (BD Bioscience, San Jose, CA). TagRFP emission was triggered by 561 nm laser ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitation experiments were performed by incubating 100 μg of protein with 2.5 μg of anti-RIPK1 (BD Transduction Laboratories) with rotation at 4 °C for 48 h ...
-
bioRxiv - Immunology 2022Quote: ... and the levels of protein surface expression were analyzed by flow cytometry using a FACS Canto II (BD Biosciences). The data obtained by flow cytometry were analyzed with FlowJo software (Tree Star).
-
bioRxiv - Physiology 2020Quote: ... The following primary antibodies detected the proteins of interest: mouse anti-α-CaMKII (1:3000; BD, NJ, USA; 611292); rabbit anti-α-actin (1:3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... stimulation with GolgiStop solution being added for a total of 5 hours block intra-cellular protein transport (BD Bioscience). As a positive control for cytokine production ...
-
bioRxiv - Immunology 2021Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Immunology 2020Quote: ... peridinin chlorophyll protein complex cyanine (PerCP-Cy™5.5) mouse anti-human CD163 (BD Biosciences; San Jose, CA, USA) and allophycocyanin (APC ...
-
bioRxiv - Immunology 2022Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were pre-stimulated with 100 ng/ml LPS together with protein transport inhibitor Golgi Plug (1:1000, BD) for 1hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Surface or total MPL proteins were stained with anti- human MPL-PE antibody (BD Pharmingen 562159; 1:50 dilution).
-
bioRxiv - Microbiology 2023Quote: PBS-washed cells were immunostained for individual surface proteins using the following antibodies: anti-BST2/Tetherin-BV421 (#566381; BD), anti-CCR5/CD195-FITC (#555992 ...
-
bioRxiv - Genetics 2023Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Cell Biology 2024Quote: ... the total protein was detected by using specific antibodies (AP2: mouse anti-AP2 μ2, BD Biosciences, 611351, (1:250), Actin ...
-
bioRxiv - Immunology 2024Quote: ... the intracellular expression of viral p27 Gag proteins was assessed by flow cytometry with a CytofixCytoperm kit (BD Biosciences). Antibodies used were as follows ...
-
bioRxiv - Cell Biology 2019Quote: Anti-Cav-1 rabbit polyclonal (cat # 610059) and anti-phos-Y14-Cav-1 mouse monoclonal (cat # 611338) antibodies were from BD Transduction (San Jose ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated with primary antibodies diluted in PBS containing 2% NHS overnight (1:500 rabbit anti-Iba1, Abcam, ab178846; 1:200 mouse anti-Map2, BD Pharmagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were further incubated for 1 hr in solution containing goat anti-rabbit antibody conjugated with FITC (BD Biosciences, USA). All steps were carried out at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cat. No. 600-101-215], 1:100 rabbit anti-Msn [Abcam, Cat. No. ab52490], 1:25 rat anti-CD31 [BD Bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... the infected cells were incubated with a rabbit anti-Streptococcus group D antiserum (BD Diagnostics, Le Pont de Claix, France) diluted at 1:1000 in 2% BSA in PBS-Ca-Mg for 1 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... the sections were incubated with HypoxyprobeTM rabbit anti-pimonidazole antibody (1:250; hpi) for pimonidazole staining or rat anti-mouse CD31 antibody (1:250; BD) for CD31 staining overnight at 4℃ ...
-
bioRxiv - Immunology 2020Quote: ... Samples were then washed with 2% and stained with 2% FCS in PBS and subsequently washed stained with goat anti-rabbit IgG –FITC secondary (BD) for 30 minutes at RT ...
-
bioRxiv - Systems Biology 2019Quote: ... Purified rabbit anti-active caspase 3 (559565) and Alexa Fluor® mouse anti-cleaved PARP (558710) were purchased from BD Pharmingen ...
-
bioRxiv - Cancer Biology 2022Quote: ... diluted in blocking buffer at 4 °C over-night and then incubated for 30 minutes at room temperature with anti-rabbit IgG coupled with FITC (BD). After washing ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were successively incubated with primary antibodies diluted in blocking buffer (mouse anti-G3BP1, 1:4000, BD Biosciences, rabbit anti-GFP, 1:1000, ThermoFisher, mouse anti-PKR, 1:1000, BD Biosciences ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The following primary antibodies were used in this study: anti-active Caspase-3 (rabbit, 1:500 dilution, BD Pharmingen 559565); anti-phospho histone H3 (pH3 ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed with BD Cytofix Fixation Buffer and were stained with PE Rabbit Anti-Active Caspase-3 (BD Biosciences) in BD Perm/Wash Buffer (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...