Labshake search
Citations for Becton, Dickinson and Company :
301 - 350 of 462 citations for Recombinant Rabbit FGF2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Proteins bound to the column were eluted with 3 ml Elution buffer (BD buffer with 100 mM imidazole) and aliquoted in 300 μl fractions ...
-
bioRxiv - Neuroscience 2022Quote: Antibodies used included: C-terminal binding protein-2 (mouse anti-Ctbp2; BD Transduction Labs, used at 1:200), myosin-VI (rabbit anti-myosin-VI ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins bound to the column were eluted with 3 ml elution buffer (BD buffer with 100 mM imidazole) and aliquoted in 300 μl fractions ...
-
bioRxiv - Biophysics 2020Quote: ... the sorted cell population was analyzed 1 hour after induction of protein expression by flow cytometry (Instrument: BD FACS-Aria SORP cell sorter ...
-
bioRxiv - Pathology 2022Quote: ... with allophycocyanin (APC) against B220 and with peridinin-chlorophyll proteins (PerCP-Cy™ 5.5) against CD45 from BD Pharmingen were diluted at 1/50 in PBS ...
-
bioRxiv - Immunology 2019Quote: ... HK Mtb or LPS (100 ng/mL) for 24h and the Golgi Plug protein transport inhibitor (BD Biosciences) was added for the last 6h according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... The proteins in the lysates were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (BD Biosciences). The phosphorylation of the ERBBs and ERK was detected on the membranes with anti-pERBB1–B4 and anti-ppERK primary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% penicillin/streptomycin and 10 mM HEPES (pH 7.4) with 25% high-protein Matrigel (product 354248; BD Biosciences)) ...
-
bioRxiv - Genetics 2022Quote: ... Anti-RPA4 (1:4000-1:8000, sheep serum, home made), Anti-Actin Protein Antibody (1:30,000, mouse) (BD Transduction Laboratory ...
-
bioRxiv - Biophysics 2023Quote: ... Flow analysis of the correlation of protein production levels was carried out on a LSR II (BD Bioscience) equipped with 405 nm ...
-
bioRxiv - Immunology 2023Quote: Cytokines were analyzed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Cells from ELISpot plate were collected in media supplemented with GolgiStop Protein Transport Inhibitor (BD Biosciences, NJ, USA) and incubated for 6 hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen or eBioscience were used for flow cytometry: Phycoerythrin (PE) or peridinin chlorophyll protein -cyanine 5.5 (PerCP-Cy5.5)-conjugated CD3 (BD Biosciences Cat#5 61808 ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies used included: C terminal binding protein-2 (mouse anti-CtBP2; BD Transduction Labs, used at 1:200), myosin-VIIA (rabbit anti-myosin-VIIA ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:200) and (2) C-terminal binding protein 2 (mouse anti-CtBP2; BD Biosciences; used at 1:200) with secondary antibodies coupled to Alexa Fluors 647 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... Cytokines were analysed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Note these experiments were carried out using early access kits from BD Genomics before the implementation of commercially-available single-cell protein/RNA assays (e.g. Feature Barcoding, 10x Genomics; BD Abseq ...
-
bioRxiv - Immunology 2021Quote: ... HRP-conjugated anti-mouse IgG (SantaCruz, Cat no. sc-2005) and anti-rabbit IgG (BD Pharmingen, Cat no. 554021) were used as secondary antibodies.
-
bioRxiv - Neuroscience 2024Quote: ... After incubation with appropriate horseradish peroxidase-conjugated secondary antibodies (HRP-linked anti-mouse or anti-rabbit IgG; BD Biosciences) at RT for 1 h ...
-
bioRxiv - Cell Biology 2019Quote: Cells expressing eGFP-tagged huntingtin proteins were harvested and eGFP expression was analyzed on an LSR Fortessa (BD Pharmingen) flow cytometer for PulSA analysis to detect protein aggregates ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were transferred to supported nitrocellulose membrane and probed using Syn101 antibodies against aSyn (BD labs, San Jose, CA). Blots were imaged on using a ChemiDoc MP imager and analyzed using Image Lab (Bio-Rad ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... cells expressing TagRFP-tagged proteins were flow-sorted using a BD Influx cell sorter (BD Bioscience, San Jose, CA). TagRFP emission was triggered by 561 nm laser ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitation experiments were performed by incubating 100 μg of protein with 2.5 μg of anti-RIPK1 (BD Transduction Laboratories) with rotation at 4 °C for 48 h ...
-
bioRxiv - Immunology 2022Quote: ... and the levels of protein surface expression were analyzed by flow cytometry using a FACS Canto II (BD Biosciences). The data obtained by flow cytometry were analyzed with FlowJo software (Tree Star).
-
bioRxiv - Physiology 2020Quote: ... The following primary antibodies detected the proteins of interest: mouse anti-α-CaMKII (1:3000; BD, NJ, USA; 611292); rabbit anti-α-actin (1:3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... stimulation with GolgiStop solution being added for a total of 5 hours block intra-cellular protein transport (BD Bioscience). As a positive control for cytokine production ...
-
bioRxiv - Immunology 2021Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Immunology 2020Quote: ... peridinin chlorophyll protein complex cyanine (PerCP-Cy™5.5) mouse anti-human CD163 (BD Biosciences; San Jose, CA, USA) and allophycocyanin (APC ...
-
bioRxiv - Immunology 2022Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were pre-stimulated with 100 ng/ml LPS together with protein transport inhibitor Golgi Plug (1:1000, BD) for 1hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Surface or total MPL proteins were stained with anti- human MPL-PE antibody (BD Pharmingen 562159; 1:50 dilution).
-
bioRxiv - Microbiology 2023Quote: PBS-washed cells were immunostained for individual surface proteins using the following antibodies: anti-BST2/Tetherin-BV421 (#566381; BD), anti-CCR5/CD195-FITC (#555992 ...
-
bioRxiv - Genetics 2023Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Cell Biology 2024Quote: ... the total protein was detected by using specific antibodies (AP2: mouse anti-AP2 μ2, BD Biosciences, 611351, (1:250), Actin ...
-
bioRxiv - Immunology 2024Quote: ... the intracellular expression of viral p27 Gag proteins was assessed by flow cytometry with a CytofixCytoperm kit (BD Biosciences). Antibodies used were as follows ...
-
bioRxiv - Cell Biology 2019Quote: Anti-Cav-1 rabbit polyclonal (cat # 610059) and anti-phos-Y14-Cav-1 mouse monoclonal (cat # 611338) antibodies were from BD Transduction (San Jose ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated with primary antibodies diluted in PBS containing 2% NHS overnight (1:500 rabbit anti-Iba1, Abcam, ab178846; 1:200 mouse anti-Map2, BD Pharmagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were further incubated for 1 hr in solution containing goat anti-rabbit antibody conjugated with FITC (BD Biosciences, USA). All steps were carried out at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cat. No. 600-101-215], 1:100 rabbit anti-Msn [Abcam, Cat. No. ab52490], 1:25 rat anti-CD31 [BD Bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... the infected cells were incubated with a rabbit anti-Streptococcus group D antiserum (BD Diagnostics, Le Pont de Claix, France) diluted at 1:1000 in 2% BSA in PBS-Ca-Mg for 1 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... the sections were incubated with HypoxyprobeTM rabbit anti-pimonidazole antibody (1:250; hpi) for pimonidazole staining or rat anti-mouse CD31 antibody (1:250; BD) for CD31 staining overnight at 4℃ ...
-
bioRxiv - Immunology 2020Quote: ... Samples were then washed with 2% and stained with 2% FCS in PBS and subsequently washed stained with goat anti-rabbit IgG –FITC secondary (BD) for 30 minutes at RT ...
-
bioRxiv - Systems Biology 2019Quote: ... Purified rabbit anti-active caspase 3 (559565) and Alexa Fluor® mouse anti-cleaved PARP (558710) were purchased from BD Pharmingen ...
-
bioRxiv - Cancer Biology 2022Quote: ... diluted in blocking buffer at 4 °C over-night and then incubated for 30 minutes at room temperature with anti-rabbit IgG coupled with FITC (BD). After washing ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were successively incubated with primary antibodies diluted in blocking buffer (mouse anti-G3BP1, 1:4000, BD Biosciences, rabbit anti-GFP, 1:1000, ThermoFisher, mouse anti-PKR, 1:1000, BD Biosciences ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The following primary antibodies were used in this study: anti-active Caspase-3 (rabbit, 1:500 dilution, BD Pharmingen 559565); anti-phospho histone H3 (pH3 ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed with BD Cytofix Fixation Buffer and were stained with PE Rabbit Anti-Active Caspase-3 (BD Biosciences) in BD Perm/Wash Buffer (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...