Labshake search
Citations for Becton, Dickinson and Company :
201 - 250 of 340 citations for Recombinant Canine CD274 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... For intracellular staining the cells were incubated for 4 h with the protein transport inhibitor GolgiPlug (BD Biosciences). For fixation and permeabilization of the cells ...
-
bioRxiv - Immunology 2019Quote: A375 cell production of chemokine proteins was quantified using a CBA Human Chemokine Kit (BD Biosciences Cat #552990) and GM-CSF production was measured using Human GM-CSF ELISA Kit (Abcam Cat #ab174448) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 µg of total protein were separated by SDS-PAGE and probed with antibodies against BUBR1 (BD BioSciences), CDC27 (BD BioSciences) ...
-
bioRxiv - Neuroscience 2020Quote: H4 protein extracts were analyzed by western-blotting probing for aSyn (anti-a-synuclein dilution 1:1000; BD Transduction Laboratories™ ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-Myosin7a (MYO7; 1:200; Proteus; RRID:AB_10013626) mouse anti-CTBP2 (aka C-Terminal Binding Protein 2; 1:200; BD Transduction Laboratories ...
-
bioRxiv - Neuroscience 2019Quote: ... the primary neurons coverslips were incubated with the primary antibodies: microtubule-associated protein 2B (MAP2B; 1:200; BD Transduction Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: The following primary antibodies were used: mouse anti-CTBP2 (aka C-Terminal Binding Protein 2; 1:200; BD Transduction Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins bound to the column were eluted with 3 ml Elution buffer (BD buffer with 100 mM imidazole) and aliquoted in 300 μl fractions ...
-
bioRxiv - Neuroscience 2022Quote: Antibodies used included: C-terminal binding protein-2 (mouse anti-Ctbp2; BD Transduction Labs, used at 1:200), myosin-VI (rabbit anti-myosin-VI ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins bound to the column were eluted with 3 ml elution buffer (BD buffer with 100 mM imidazole) and aliquoted in 300 μl fractions ...
-
bioRxiv - Biophysics 2020Quote: ... the sorted cell population was analyzed 1 hour after induction of protein expression by flow cytometry (Instrument: BD FACS-Aria SORP cell sorter ...
-
bioRxiv - Pathology 2022Quote: ... with allophycocyanin (APC) against B220 and with peridinin-chlorophyll proteins (PerCP-Cy™ 5.5) against CD45 from BD Pharmingen were diluted at 1/50 in PBS ...
-
bioRxiv - Immunology 2019Quote: ... HK Mtb or LPS (100 ng/mL) for 24h and the Golgi Plug protein transport inhibitor (BD Biosciences) was added for the last 6h according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... The proteins in the lysates were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (BD Biosciences). The phosphorylation of the ERBBs and ERK was detected on the membranes with anti-pERBB1–B4 and anti-ppERK primary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% penicillin/streptomycin and 10 mM HEPES (pH 7.4) with 25% high-protein Matrigel (product 354248; BD Biosciences)) ...
-
bioRxiv - Genetics 2022Quote: ... Anti-RPA4 (1:4000-1:8000, sheep serum, home made), Anti-Actin Protein Antibody (1:30,000, mouse) (BD Transduction Laboratory ...
-
bioRxiv - Biophysics 2023Quote: ... Flow analysis of the correlation of protein production levels was carried out on a LSR II (BD Bioscience) equipped with 405 nm ...
-
bioRxiv - Immunology 2023Quote: Cytokines were analyzed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Cells from ELISpot plate were collected in media supplemented with GolgiStop Protein Transport Inhibitor (BD Biosciences, NJ, USA) and incubated for 6 hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen or eBioscience were used for flow cytometry: Phycoerythrin (PE) or peridinin chlorophyll protein -cyanine 5.5 (PerCP-Cy5.5)-conjugated CD3 (BD Biosciences Cat#5 61808 ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies used included: C terminal binding protein-2 (mouse anti-CtBP2; BD Transduction Labs, used at 1:200), myosin-VIIA (rabbit anti-myosin-VIIA ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:200) and (2) C-terminal binding protein 2 (mouse anti-CtBP2; BD Biosciences; used at 1:200) with secondary antibodies coupled to Alexa Fluors 647 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... Cytokines were analysed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Note these experiments were carried out using early access kits from BD Genomics before the implementation of commercially-available single-cell protein/RNA assays (e.g. Feature Barcoding, 10x Genomics; BD Abseq ...
-
bioRxiv - Cell Biology 2019Quote: Cells expressing eGFP-tagged huntingtin proteins were harvested and eGFP expression was analyzed on an LSR Fortessa (BD Pharmingen) flow cytometer for PulSA analysis to detect protein aggregates ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were transferred to supported nitrocellulose membrane and probed using Syn101 antibodies against aSyn (BD labs, San Jose, CA). Blots were imaged on using a ChemiDoc MP imager and analyzed using Image Lab (Bio-Rad ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... cells expressing TagRFP-tagged proteins were flow-sorted using a BD Influx cell sorter (BD Bioscience, San Jose, CA). TagRFP emission was triggered by 561 nm laser ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitation experiments were performed by incubating 100 μg of protein with 2.5 μg of anti-RIPK1 (BD Transduction Laboratories) with rotation at 4 °C for 48 h ...
-
bioRxiv - Immunology 2022Quote: ... and the levels of protein surface expression were analyzed by flow cytometry using a FACS Canto II (BD Biosciences). The data obtained by flow cytometry were analyzed with FlowJo software (Tree Star).
-
bioRxiv - Physiology 2020Quote: ... The following primary antibodies detected the proteins of interest: mouse anti-α-CaMKII (1:3000; BD, NJ, USA; 611292); rabbit anti-α-actin (1:3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... stimulation with GolgiStop solution being added for a total of 5 hours block intra-cellular protein transport (BD Bioscience). As a positive control for cytokine production ...
-
bioRxiv - Immunology 2021Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Immunology 2020Quote: ... peridinin chlorophyll protein complex cyanine (PerCP-Cy™5.5) mouse anti-human CD163 (BD Biosciences; San Jose, CA, USA) and allophycocyanin (APC ...
-
bioRxiv - Developmental Biology 2020Quote: ... Prox1 and pErkT202/Y204 proteins were detected non-fluorescently using biotinylated goat anti-rabbit IgG (1: 400, BD Biosciences) followed by avidin-HRP and DAB detection (Vector labs ...
-
bioRxiv - Immunology 2022Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were pre-stimulated with 100 ng/ml LPS together with protein transport inhibitor Golgi Plug (1:1000, BD) for 1hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Surface or total MPL proteins were stained with anti- human MPL-PE antibody (BD Pharmingen 562159; 1:50 dilution).
-
bioRxiv - Microbiology 2023Quote: PBS-washed cells were immunostained for individual surface proteins using the following antibodies: anti-BST2/Tetherin-BV421 (#566381; BD), anti-CCR5/CD195-FITC (#555992 ...
-
bioRxiv - Genetics 2023Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Cell Biology 2024Quote: ... the total protein was detected by using specific antibodies (AP2: mouse anti-AP2 μ2, BD Biosciences, 611351, (1:250), Actin ...
-
bioRxiv - Immunology 2024Quote: ... the intracellular expression of viral p27 Gag proteins was assessed by flow cytometry with a CytofixCytoperm kit (BD Biosciences). Antibodies used were as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies (anti-Cas9 7A9-3A3, Cell Signaling Technology #14697S, anti-γ-tubulin Sigma#T5326, anti-Human Retinoblastoma protein BD Pharmigen #554136 ...