Labshake search
Citations for Becton, Dickinson and Company :
501 - 550 of 943 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... 200 RPE1 cells were sorted into each well of 96-well plates by flow cytometry (FACSJazz, BD Bioscience). For the CIN screen and follow up screens ...
-
bioRxiv - Microbiology 2019Quote: Hemolytic assays were performed by using TSB-containing 5% sheep blood agar plates (Becton, Dickinson and Company, Japan). Three microliters of overnight culture was spotted on the agar plate ...
-
bioRxiv - Genomics 2021Quote: Each strain was cultivated in deep well plates containing 400 μL of ISP1 (BD Diagnostic, catalog no 276910) or R2A media (Teknova ...
-
bioRxiv - Cell Biology 2021Quote: ... we sorted single clone GFP positive cells into 96-well U-bottom plate by flow cytometry (BD Aria). It takes ∼3 weeks for cell re-population ...
-
bioRxiv - Genomics 2020Quote: ... Ninety-five NeuN+ single nuclei were sorted into a 96-well plate by FACS (BD FACSAria™ III). Whole genome amplification was performed by multiple displacement amplification (MDA ...
-
bioRxiv - Immunology 2022Quote: ... 1×104 cells/well of early and late passage were seeded in 12-well culture plates (BD Falcon). Cell number and viability were examined each day in triplicate wells using trypan blue exclusion and cell proliferative assay (# Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50,000 AML cells were seeded in 200 µL complete media in 48 well non-TC plates (BD Falcon), and treated with varying doses (from 1 nM to 1 mM ...
-
bioRxiv - Microbiology 2022Quote: ... Solubilized wells were serially diluted 10-fold and plated onto TSA 5% sheep blood agar plates (BD Biosciences) to enumerate bacteria present.
-
bioRxiv - Microbiology 2022Quote: ... 100 μL of enrichment culture of each substrate was spread on a Marine Agar 2216 plate (MA, BD), and the culture plate was maintained at 15°C for 5 days under anaerobic conditions until many visible colonies were observed ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were sorted to 384well lysis plates using a FACSAria-III or Symphony S6 flow cytometer (BD Biosciences), excluding doublets and cell debris by FSC and SSC metrics.
-
bioRxiv - Molecular Biology 2022Quote: ... a 48-well plate was coated with 150 µl Matrigel per well (growth factor-reduced, #354230, BD Pharmingen) for 30 min at 37 °C before adding 100,000 HUVECs in 250 µl medium with the supernatant of either siScr-treated or sicPlod2-treated pericytes ...
-
bioRxiv - Immunology 2023Quote: ... plates were coated with 50 μl of 2 μg/ml anti-mouse IgE (clone R35-72M; 553413, BD) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... We sorted tdTomato-positive/DAPI- negative cells into 4 96-well plates using an ARIA Sorter III (BD) and BD FACSDiva software 8.0.1.
-
bioRxiv - Developmental Biology 2023Quote: ... Tissue culture plates were coated for 1 hour at room temperature with BD ES-qualified Matrigel (BD Biosciences) diluted according to the manufacturer’s instructions in ice cold DMEM/F-12 ...
-
bioRxiv - Microbiology 2023Quote: ... and Columbia blood agar plates supplemented with 5% sheep’s blood (CB) (Becton, Dickinson and Company, Sparks, MD, USA). Similarly ...
-
bioRxiv - Cell Biology 2023Quote: ... assay plates were prepared the day of the assay by adding 10 mL of 2% Difco-agar (BD) in assay buffer (5 mM potassium phosphate ...
-
bioRxiv - Cancer Biology 2023Quote: ... the population was single-cell FACS-sorted into 96-well plates containing RPMI11+2S (BD FACSMelody Cell Sorter). After 1.5-2 weeks ...
-
bioRxiv - Immunology 2023Quote: ... Cells were plated in 96-well plates coated with anti-CD3 antibody (5μg/ml, BD, clone 145-2C11) at a density of 3 x 106 cells/ml ...
-
bioRxiv - Immunology 2023Quote: Cells from ELISpot plate were collected in media supplemented with GolgiStop Protein Transport Inhibitor (BD Biosciences, NJ, USA) and incubated for 6 hr at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... the plate was incubated with biotin-labeled detection antibody rat anti-mouse IgG1 (clone A85-1; BD Pharmingen) at a concentration of 1 µg/ml diluted in blocking solution for 1 h at RT ...
-
bioRxiv - Immunology 2023Quote: ... cells were sorted into 96-well plates (1 cell/well) using BD FACS Melody Cell Sorted (BD Biosciences). Two to three weeks after sorting ...
-
bioRxiv - Biochemistry 2023Quote: ... nanobodies were purified with a 96-wells HIS-TRAP plate or a Cobalt-NTA (Talon) column (BD Biosciences), eluting with a buffer containing 25 mM HEPES (pH 7.8) ...
-
bioRxiv - Cancer Biology 2023Quote: ... single cells were deposited in 96 well plates using a BD FACSAria III (BD Biosciences, Franklin Lakes, NJ). Outgrowing clones were condensed to a 96 well plate in duplicate to propagate clones and generate a genomic DNA source ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed again with PBS+Tween-20 0.05% followed by the addition of TMB substrate (BD, 555214). Plates were allowed to develop for 10-25 minutes before adding 1M H2SO4 stop solution ...
-
bioRxiv - Cell Biology 2023Quote: ... single cells were deposited in 96-well plates by flow sorting with a FACS Aria III (BD Biosciences). Single clones were expanded and DNAs were prepared from 81 clones ...
-
bioRxiv - Immunology 2023Quote: ... and positive control cells were incubated in plates coated with anti-CD3 (1μg/ml) (clone HIT3a, BD Biosciences). Results were expressed as cell division index which is the ratio of %CFSElow splenocytes (proliferating splenocytes ...
-
bioRxiv - Cell Biology 2023Quote: 50,000 cells per well were seeded in a 24-well plate (Corning Inc. BD Falcon, Corning, NY, USA) and incubated for 48h ...
-
bioRxiv - Cancer Biology 2023Quote: ... At 48h ATTO550+ve single cells were FACS sorted into 96-well plates (BD FACSAria Fusion cell sorter) and ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 48h cultures were diluted and plated on Nutrient Agar plates (5 g/L peptone BD difco, BD Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... An IncuCyte 96-Well ImageLock plate was coated with Matrigel (BD 354230, 1:20 with serum-free media) for 12 h ...
-
bioRxiv - Systems Biology 2023Quote: ... Naïve T cells were activated with plate bound anti-CD3ε (5 µg/ml, clone: 145-2C11, BD Biosciences) and soluble anti-CD28 (0.5 µg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... Liquid nitrogen stocks of PC12 cells were plated on Falcon flat-bottomed 96-well plates) (#353219; BD Falcon), each well containing ∼3.0 104 cells in 100 µl growth media ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells expressing HaloTag were subjected to single-cell sorting into 96-well plates (FACSAria Fusion, BD Biosciences).
-
bioRxiv - Microbiology 2023Quote: ... Bacteria were cultured on Tryptic Soy agar plates or in filter-sterilized Tryp-c Soy broth (BD Diagnostics). All cultures were incubated at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were iced 30 minutes and detached trophozoites were transferred to 8 ml screw-capped tubes (BD Falcon). Once these tubes reached >50% confluency ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Microbiology 2019Quote: ... strains were streaked onto Trypticase Soy Agar II plates (TSA) containing 5% sheep blood (BD BBL, New Jersey, USA). For growth in liquid culture ...
-
bioRxiv - Immunology 2021Quote: ... BMDMs or iBMDMs were routinely plated at 4×105 cells/well in 24-well tissue culture plates (BD Falcon) or 1×105 cells/well in 96-well flat bottom tissue culture plates ...
-
bioRxiv - Genomics 2020Quote: ... 100μl cell suspension medium was seeded in each well of 96 well plates (BD Biosciences, Franklin Lakes, NJ, USA) and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Physiology 2022Quote: Primary mouse hepatocytes were cultured in BD BioCoat™Collagen 6-well plates (BD Pharmingen, Franklin Lakes, NJ, USA) at 1-1.5 x 106 cells per well in William’s medium (catalog n°12551032 ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Cancer Biology 2019Quote: ... populations of knockout (or control) cells were FACS sorted as single cells in 96-well plates (BD FACSAria II) and allowed to grow for approximately 2 weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... MLO-Y4 cells were cultured as described on plastic tissue culture plates coated with rat-tail collagen I (BD). These cells are cultured in 2.5% heat-inactivated Fetal Bovine Serum (Characterized ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...
-
bioRxiv - Cell Biology 2019Quote: ... Established iSML iPSCs were maintained in Nutristem-XF (Biological Industries) in plates coated with hESC-qualified matrigel (BD Biosciences) and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Neuroscience 2019Quote: ... Rat hippocampal cells were plated on poly-D lysine coated 96 well imaging plates (BD Biosciences, San Jose, CA) (~16 plates per week ...
-
bioRxiv - Microbiology 2021Quote: ... Single colony was stab-inoculated with a sterile toothpick on the surface of LBNS plates (0.3% BD Bacto Agar). Plates were incubated upright at 37 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on PDL-coated 96-well microplates (7000 cells per well; black/clear imaging plate, BD Falcon 353219). RGCs were cultured in serum-free medium (Neurobasal/Invitrogen ...