Labshake search
Citations for Becton, Dickinson and Company :
151 - 200 of 1220 citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... the BDTM Human Single-Cell Multiplexing kit (BD Biosciences) was used to label the cells from each donor with unique sample tag ...
-
bioRxiv - Pathology 2021Quote: Using BD Rhapsody™ Cartridge Reagent Kit (BD, 633731) and BD Rhapsody™ Cartridge Kit (BD ...
-
bioRxiv - Cancer Biology 2019Quote: The PE Annexin-V Apoptosis Detection Kit (BD Biosciences) was used to detect apoptosis following manufacturer’s instruction ...
-
bioRxiv - Immunology 2019Quote: ... Fixation and permeabilization buffers from BD Cytofix/Cytoperm™ Kit (BD Biosciences, San Jose, CA) were used ...
-
bioRxiv - Neuroscience 2019Quote: ... permeabilized using Fixation/Permeabilization Kit (1X, 4338045, BD Biosciences) according to the protocol of the manufacturer ...
-
bioRxiv - Pathology 2021Quote: ... and the Cytofix/Cytoperm Fixation/Permeablization kit (BD, Germany) were used according to the manufacturer’s protocol to stain for intracellular molecules (intranuclear and cytoplasmic molecules ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer’s protocol (BD Cytofix/Cytoperm kit).
-
bioRxiv - Microbiology 2020Quote: ... Human MMP-9 ELISA kit was purchased from BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... Then immunostaining was performed using a CytofixCytoperm kit (BD) and the following monoclonal antibodies ...
-
bioRxiv - Immunology 2020Quote: ... using the Cytofix/Cytoperm fixation/permeabilization solution kit (BD) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 ELISA kits (BD Biosciences, Palo Alto, CA), IL-1β ...
-
bioRxiv - Immunology 2020Quote: ... and analyzed with CBA analysis kit (BD, Carlsbad, CA), according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... A cytometric bead-based multiplex assay kit (BD Biosciences) was used to measure the concentration of IFN-γ ...
-
bioRxiv - Immunology 2020Quote: ... was performed using the Cytofix/Cytoperm kit (BD Biosciences) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and stained with a Phosflow staining kit (BD Biosciences) using the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer’s protocol (BD Cytofix/Cytoperm kit).
-
bioRxiv - Immunology 2022Quote: ... following the BrdU Flow Kit manufacturer’s instructions (BD Pharmingen). For Ki67 analysis ...
-
bioRxiv - Immunology 2022Quote: ... and treated with a Cytofix/Cytoperm kit (BD Biosciences) per manufacturer protocol.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Human IL-1β ELISA kit was obtained from BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: A human Th1/Th2/Th17 Cytokine Kit (BD Biosciences) was used to measure the production of cytokines as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... fixed/permeabalized using the BD cytofix/cytoperm kit (BD), and stained with anti-IFNγ (XMG1.2 ...
-
IRF1 regulates self-renewal and stress-responsiveness to support hematopoietic stem cell maintenancebioRxiv - Cell Biology 2023Quote: BD Annexin V: FITC Detection kit I (BD Pharmingen) was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... intracellular staining was performed using Citofix/CytopermTM kit (BD) following manufacturer instructions and using the following antibodies ...
-
bioRxiv - Immunology 2023Quote: ... mouse and human IFNγ OptEIA ELISA Kits (BD Biosciences) were used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... the BD Cytofix/Cytoperm kit (BD Biosciences Cat. 554714) and FOXP3 Transcription Factor Staining Buffer set (eBioscience Cat ...
-
bioRxiv - Immunology 2023Quote: ... CytoFix/CytoPerm and Perm/Wash Buffer kit (BD, 554714) was used for intracellular staining steps ...
-
bioRxiv - Bioengineering 2022Quote: ... IFNγ and TNFα ELISA kit were purchased from BD Biosciences (San Jose ...
-
bioRxiv - Immunology 2022Quote: ... fixed and permeabilized with Cytofix/Cytoperm kit (BD Biosciences) prior to acquisition using FACSymphony ...
-
bioRxiv - Immunology 2023Quote: ... by using Cytofix/CytoPerm Plus kit (555028; BD Pharmingen). Samples were analyzed using a Fortessa flow cytometer (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using the Fixation/Permeabilization Kit (BD Biosciences #554714), and stained intracellularly ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using a Cytofix/Cytoperm solution kit (BD Biosciences), and intracellularly stained with anti-TNF-Alexa 700 (alone MAB11) ...
-
bioRxiv - Immunology 2023Quote: ... FITC-anti-BrdU (BD, BrdU flow kit, Cat#559619), Zombie Aqua fixable viability kit (BioLegend ...
-
bioRxiv - Pathology 2023Quote: ... WBC were quantified using the Leucocount Kit (BD, 340523). Platelet unit pH was measured daily by adding 25 μL of the platelet unit to pH strips with a pH range of 5-9 (Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... labeled with Mouse Immune Single-Cell Multiplexing Kit (BD) and loaded on a microwell cartridge of the BD Rhapsody Express system (BD ...
-
bioRxiv - Immunology 2023Quote: ... using Cytofix/Cytoperm Fixation/Permeabilization Solution kit (BD Biosciences) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Viability was analyzed with Kit 7AAD/Annexin (BD Pharmingen), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... or Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (BD Bioscences) according to manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The Cytokine Bead Array kit was procured from BD Biosciences ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... FITC-Annexin V apoptosis detection kit 1 (BD PharmingenTM) was used to evaluate compound-induced apoptosis ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Cancer Biology 2021Quote: Cell cycle analysis was performed using the BrdU Flow Kit according to the manufacturer protocol (BD, FITC BrdU Flow Kit; Cat. No. 559619), with cells pulsed with BrdU for 1 hour at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: pEU-E01 cell-free wheat germ expression vector containing ampicillin resistance and cell-free wheat germ expression kit (Cat# CFS-CPLE-BD Proteoliposome BD Kit) were obtained from CellFree Sciences Co. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PE Annexin V Apoptosis Detection Kit II from BD Biosciences was used to detect apoptotic T cells according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2019Quote: ... HSPCs were stained using c-Kit-APC (2B8; BD Biosciences), Sca-1-Cy7PE (D7 ...
-
bioRxiv - Bioengineering 2019Quote: ... Monocytes were enriched by using monocytes enrichment kit (BD biosciences) according to the manufacture instructions ...
-
bioRxiv - Immunology 2019Quote: The Cytokine Bead Array Mouse Inflammation kit (BD Biosciences 552364) was used according to manufacturer’s instructions for simultaneous measurement of IL-6 ...
-
bioRxiv - Immunology 2020Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Cancer Biology 2020Quote: ... the Apoptosis Detection Kit was used (BD Pharmingen, Bedford, USA), and cells were washed and resuspended in binding buffer ...