Labshake search
Citations for Becton, Dickinson and Company :
151 - 200 of 6392 citations for Mouse Two pore calcium channel protein 2 Tpcn2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... anti-BCL-2 (1:1,000, mouse mAb, BD bioscience, 610538), anti-JNK1 (1:1,000 ...
-
bioRxiv - Immunology 2023Quote: ... Concentrations were determined using mouse IgE (C48-2, BD, 557080) as a standard ...
-
bioRxiv - Neuroscience 2020Quote: ... Human Soluble Protein buffer kit (BD Biosciences) was used in conjunction with flex sets for detecting granulocyte-macrophage colony-stimulating factor (GM-CSF) ...
-
bioRxiv - Neuroscience 2020Quote: ... for 1 h at room temperature followed by overnight incubation at 37°C in antibodies to the following: (1) C-terminal binding protein 2 (mouse anti-CtBP2; BD Biosciences, used at 1:200). (2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Microdissected pieces were immunostained with antibodies to the following: (1) mouse anti-C-terminal binding protein 2 (pre-synaptic-marker, BD Biosciences, 1:200, Cat # 612044), (2 ...
-
bioRxiv - Neuroscience 2023Quote: ... glial fibrillary acidic protein (GFAP, mouse, 1:500, BD556330, BD bioscience) and ionized calcium binding adaptor protein 1 (Iba1 ...
-
bioRxiv - Physiology 2023Quote: ... MLEC were purified after propagating them two times by sorting CD31+/CD144+ cells as described above (anti-mouse CD31-antibody, BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... and the concentration of IL-2 in culture supernatants was determined by ELISA according to the manufacturer’s instructions (BD Biosciences).
-
bioRxiv - Immunology 2022Quote: ... Plates were washed five times and developed with tetramethylbenzidine (1-Step Ultra TMB-ELISA Substrate Solution, Thermo Fisher Scientific, for the RBD ELISA, and BD OptEIA Substrate Solution, BD Biosciences, for the spike ELISA) for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ELISA was performed by coating ELISA plates (nunc) either with unconjugated anti-IgE (R35-92, BD,) allergen extracts (5 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse inflammation CBA kit was from BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... Calcium mobilization was recorder on an LSR II flow cytometer (BD Biosciences) by measuring the 405/485-nm emission ratio of Indo-1 fluorescence upon UV excitation at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... transwell inserts (8.0 μm pore size) (BD, catalog no. 353097) containing cancer cells at a cell density of 20,000/insert were fitted into the 6-well plate containing CM of stromal cells ...
-
bioRxiv - Immunology 2020Quote: ... and filtered through a 70μm pore cell strainer (BD Biosciences). Single-cells suspensions were stained with 1μM Live/Dead Aqua Dead Cell Stain Kit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: Well inserts with a 0.4 mm pore size filter (BD Falcon ...
-
bioRxiv - Microbiology 2023Quote: ... 96-well ELISA plates (BD Bioscience) were coated overnight with capture antibody at 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: The titles and abstracts of 2 341 articles retrieved from the preliminary search were screened and cross-checked by two independent reviewers (ZL and BD) and discrepancies were resolved through discussion with a third researcher (DM) ...
-
bioRxiv - Cell Biology 2019Quote: ... For CCL2/MCP1 and CCL5/RANTES detection BD ELISA kits (OptEIA Set, BD Biosciences, San Diego, CA) were used ...
-
bioRxiv - Microbiology 2024Quote: ... The antibodies employed for ELISA were biotin-conjugated rat anti-mouse IgG2a (clone R19-5, BD Biosciences, Denmark cat no. 550332) and anti-mouse IgG conjugated to horseradish peroxidase (HRP ...
-
bioRxiv - Bioengineering 2023Quote: ... Mixing was achieved by pumping the two materials in two 10mL syringes (BD Emerald, NY, USA) back and forth through a 90-degree syringe luer lock connector (McMaster-Carr ...
-
bioRxiv - Immunology 2020Quote: 2 μl of FITC mouse anti-human CD3 (BD Pharmigen Biosciences), 2 μl mouse anti-human CD14 APC (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... BV786 Rat Anti-Mouse CD138 (Syndecan-1) (Clone 281-2; BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... Biotin Rat Anti-Mouse CD138 (Syndecan-1) (Clone 281-2; BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... PE anti-mouse CD8a (Ly-2)(53-6.7) (cat # 553032, BD), Anti-mouse CD69 FITC clone ...
-
bioRxiv - Immunology 2024Quote: ... 2 mL 200 mg/mL BV711-mouse-anti-human CD49a (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... using 1:20 diluted plasma. FLT3L ELISA (cat. # DY308, R&D) and GMCSF ELISA (cat. # 555126, BD) were performed with 1:2 diluted plasma ...
-
bioRxiv - Cancer Biology 2022Quote: ... The ELISA was then performed as per the manufacturer’s instructions (BD Bioscience IL-6 ELISA Cat. #555220), and concentrations determined by interpolating absorbance values of samples using a standard curve.
-
bioRxiv - Cell Biology 2020Quote: ... DNA content was measured using the FL2 channel of FACSCaliburTM (BD Biosciences, Germany). Remaining cells were subjected to chromatin cross-linking.
-
bioRxiv - Cancer Biology 2022Quote: ... Fluorescence was analyzed in the FITC channel on a LSRFortessa flow cytometer (BD).
-
bioRxiv - Bioengineering 2023Quote: ... while the basal channel was coated with 100 µg/mL Matrigel (BD Biosciences) and 200 µg/mL type I collagen in cold DPBS ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of antibody was quantified in plates coated in triplicate with two-fold dilutions of an appropriate purified mouse Ig isotype standard (IgG and IgA; BD Biosciences), starting at 0.5 μg/μl ...
-
bioRxiv - Biophysics 2020Quote: ... After incubation cell free supernatant was collected and subjected to sandwich ELISA using IL-2 specific antibody (BD biosciences, CA, USA) as per manufacturer instruction.
-
bioRxiv - Immunology 2019Quote: ... Cytokine concentration was quantified in the supernatants by cytometric bead array (CBA) according to the manufacturer’s instructions from the Mouse/Rat Soluble Protein Flex Set System kit (BD Biosciences Pharmingen, Oxford, UK). CBA data was analysed on a MACSQuant analyser with MACSQuantify™ Software and the CBA analysis software package (BD Biosciences).
-
bioRxiv - Cell Biology 2020Quote: ... Two hybrid plasmid pKBB486 (Crm1-BD) was constructed by PCR amplification of full-length CRM1 using oligonucleotides 5’- TGAAGATACCCCACCAAACCCAAAAAAAGAGATCGAATTCCAGCTGACCACCATGGAAGGAATTTTGGA TTTTTCTAACG-3’ and 5’- TTTTCAGTATCTACGATTCATAGATCTCTGCAGGTCGACGGATCCCCGGGAATTGCCATGTAATCATCAA GTTCGGAAGG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Monoclonal antibody against mouse Golgi matrix protein GM130 was purchased from BD Biosciences ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used for immunofluorescence of mouse tissue were: mouse anti-Ataxin-2 (BD Biosciences 611378, 1:250), rabbit anti-Caprin1 (Proteintech ...
-
bioRxiv - Immunology 2022Quote: ... 0.75 × 105 naïve T cells were cultured for one or two days with plate-bound anti-CD3ε (2 µg/ml, clone 145-2C11; BD Biosciences) in differentiation medium consisting of RPMI1640 supplemented with 1% penicillin/streptomycin ...
-
bioRxiv - Physiology 2024Quote: ... endothelial cells were purified by two consecutive immuno-selection procedures using magnetic beads conjugated with anti-ICAM-2 antibody (BD Pharmingen) and plated into 75 cm2 tissue culture coated flasks ...
-
bioRxiv - Neuroscience 2019Quote: ... mIL-6 levels were evaluated using sandwich capture ELISA assays using the RIPA soluble mouse forebrain lysates as per manufacturer’s instructions (BD OptiEIA, BD Biosciences).
-
bioRxiv - Neuroscience 2023Quote: ... Concentrations of IL-1β and IL-6 were assayed according to protocol using commercially available mouse IL-1β and IL-6 ELISA (BD Bioscience, Australia). UV absorbance was quantified on a BMG PolarStar microplate reader (BMG Labtechnologies ...
-
bioRxiv - Immunology 2020Quote: ... Calcium flux analysis was performed on an LSRII cytometer (BD, San Jose, CA). Kinetic analysis was performed using FlowJo (Tree Star ...
-
bioRxiv - Biochemistry 2019Quote: ... The plates were washed 3 times using PBST and then developed using an ELISA developing kit (BD Biosciences). The optical densities at 450 nm were read using an ELISA plate reader (Molecular Devices).
-
bioRxiv - Cancer Biology 2019Quote: ... the concentration of IFN-γ in the supernatant was detected using the IFN-γ ELISA kit (BD Biosciences) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Extracellular levels of IL-8 were estimated using BD OptiEIA™ Human IL8 ELISA kit (BD Biosciences, USA) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed twice in PBS + 2% FCS + 2 mM EDTA and incubated with mouse FcBlock (BD Biosciences), Epcam-APC (CD326 Monoclonal Antibody (G8.8) ...
-
bioRxiv - Physiology 2021Quote: ... and COX-2 (anti-COX-2: cat#: 610204, source: mouse, 1:1000; BD Biosciences, San Jose, CA, USA). The immunostaining was detected using horseradish peroxidase-conjugated anti-rabbit immunoglobulin G (IgG ...
-
bioRxiv - Cancer Biology 2020Quote: ... PC3s were plated into transwells (8 μM pore size, BD Bioscience) at a density of 500,000 cells/well in serum free media and allowed 48 hr to migrate towards serum containing media ...
-
bioRxiv - Cancer Biology 2020Quote: ... using 8 μm pore size membrane transwells (BD Bioscience, Bedford, MA).
-
bioRxiv - Cancer Biology 2023Quote: The 8μm pore size chamber (Costar, USA) and Matrigel (BD, USA) were used for cell migration and invasion assays ...
-
bioRxiv - Cancer Biology 2020Quote: ... IL-1β ELISA was purchased from BD. Z-VAD-fmk and z-YVAD-fmk were from Enzo Life Science.