Labshake search
Citations for Becton, Dickinson and Company :
251 - 300 of 8113 citations for Huntingtin Interacting Protein 1 Related Protein HIP1R Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody and Drp1 with α-DLP1 primary antibody (diluted 1:1000, BD # 611112). Cells were incubated with anti-rabbit Alexa 568 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-Munc18-1 mouse monoclonal antibody (BD Biosciences #610337; 1:1000) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies (mouse E-cadherin, 1:1500, BD Biosciences ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1:100 α-eCdh1 antibody (BD Biosciences #610181) was added overnight with the probes in hybridization buffer ...
-
bioRxiv - Bioengineering 2020Quote: ... and OCT4 antibody (611202, BD Biosciences, 1:500). Cells were washed three times in 1xPBS with 0.1 % Tween 20 prior to incubation with secondary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were: CDH1 (BD Biosciences #610181, 1:200); EPCAM-AF647 (Abcam #ab239273 ...
-
bioRxiv - Biochemistry 2022Quote: ... and aSN (primary antibody: anti-Syn-1, BD Transduction Laboratory ...
-
bioRxiv - Neuroscience 2022Quote: ... rat CD31 antibody (BD Biosciences, # 553370; 1:100), mouse anti-SOX10 antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2019Quote: (1) IdU primary antibody (mouse anti-BrdU, BD Biosciences 347580 ...
-
bioRxiv - Cell Biology 2019Quote: ... Antibody used: Rb (BD Biosciences #554136, 1:250). When EdU needs to be incorporated ...
-
bioRxiv - Cancer Biology 2019Quote: ... Primary antibodies: RIPK1 (1:1000, 610458, BD biosciences); RIPK3 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:500 mouse anti-GM130 antibody (BD Bioscience), 1:500 mouse polyclonal anti-Golgin97 antibody (Abcam) ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-Flk-1 (VEGFR2) antibody was from BD Biosciences (555307 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-CD31 antibody (1:50, 565629, BD Biosciences), anti-Collagen (Type-IV ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies used: MAP2B 1:500 (BD Biosciences). Images were acquired with Leica SP8 confocal microscope and processed with Fiji (v ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse Aim-1 antibody (BD Transduction Laboratories; 611082) diluted 1:1,000 (serum) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining with ALDH1A1 antibody (1:500, BD biosciences) was followed by Alexa fluor-488 anti-mouse antibody (1:1000 ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... cells expressing TagRFP-tagged proteins were flow-sorted using a BD Influx cell sorter (BD Bioscience, San Jose, CA). TagRFP emission was triggered by 561 nm laser ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitation experiments were performed by incubating 100 μg of protein with 2.5 μg of anti-RIPK1 (BD Transduction Laboratories) with rotation at 4 °C for 48 h ...
-
bioRxiv - Immunology 2022Quote: ... and the levels of protein surface expression were analyzed by flow cytometry using a FACS Canto II (BD Biosciences). The data obtained by flow cytometry were analyzed with FlowJo software (Tree Star).
-
bioRxiv - Cancer Biology 2021Quote: ... stimulation with GolgiStop solution being added for a total of 5 hours block intra-cellular protein transport (BD Bioscience). As a positive control for cytokine production ...
-
bioRxiv - Immunology 2020Quote: ... peridinin chlorophyll protein complex cyanine (PerCP-Cy™5.5) mouse anti-human CD163 (BD Biosciences; San Jose, CA, USA) and allophycocyanin (APC ...
-
bioRxiv - Genetics 2023Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Immunology 2024Quote: ... the intracellular expression of viral p27 Gag proteins was assessed by flow cytometry with a CytofixCytoperm kit (BD Biosciences). Antibodies used were as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... and probed with an anti-Xenopus Pum1 mouse monoclonal antibody (1:1000 dillution) (Pum2A5) and an anti-GM130 mouse monoclonal antibody (1:250 dillution) (BD Biosciences). The intensity of signals was quantified using ImageJ software.
-
bioRxiv - Microbiology 2021Quote: ... 0.5–1 million cells were stained with one of the following primary antibodies: mouse anti-PSGL1 antibody (KPL-1) (BD Pharmingen), mouse anti-CD43 antibody (1G10 ...
-
bioRxiv - Microbiology 2023Quote: ... Following antibodies were used as primary antibodies: 1:100 mouse anti-human CD31 (BD Pharmingen), 1:100 a mouse anti-human CD34 (Biolegend) ...
-
bioRxiv - Cell Biology 2023Quote: Primary antibodies in this study were: mouse monoclonal antibody against human Fibronectin (1:100; BD Transduction Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse monoclonal antibodies to Aurora B (AIM-1; BD Bioscience 611082, 1:100) and H3S10ph (6G3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Intracellular antibodies used include: anti-TCRβ(BD 1:400), anti-Ki67(Thermo 1:400 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Extracellular antibodies used include: anti-B220 (BD 1:400), anti-CD4 (Tonbo) ...
-
bioRxiv - Cell Biology 2019Quote: ... Antibodies were: Mcm2 (BD Biosciences Cat#610700, 1:10,000), Cyclin E1 (Cell Signaling Technology #4129S ...