Labshake search
Citations for Becton, Dickinson and Company :
1 - 50 of 1940 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: IFN-γ ELISpot assays were performed using the Human IFN-γ ELISpot Pair (BD, #551873), 96-well ELISpot plates (Millipore ...
-
bioRxiv - Immunology 2023Quote: ... modifications to the protocol were made: 1 μl of 2 μM additive primer (BD Genomics, beta kit) specific to the antibodies tags was added to the amplification mixture ...
-
bioRxiv - Immunology 2023Quote: ... A target primer panel was constructed by combining a commercial predesigned Human T Cell Expression Primer Panel (BD Biosciences, 259 target primers) with our custom-designed primer panel (BD Biosciences) ...
-
bioRxiv - Genetics 2022Quote: ... Beta Diversity (BD) Analysis was used to assess differences in sample species complexity ...
-
Evolution of immune genes in island birds: reduction in population sizes can explain island syndromebioRxiv - Evolutionary Biology 2022Quote: ... 9 Beta Defensins (BD), 2 Major Histocompatibility Complex (MHC ...
-
bioRxiv - Cell Biology 2023Quote: ... Beta-Catenin (BD, 610154), p-AKT473 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2024Quote: ... CD19 and CD20 using mouse anti-human lineage cocktail 3 (lin 3, BD bioscience). NKG2A and NKG2C-expressing NK cells were identified using anti-NKG2A (clone Z199 ...
-
bioRxiv - Microbiology 2022Quote: ... A mouse C3a ELISA pair (BD) was used as previously described(97 ...
-
bioRxiv - Cell Biology 2022Quote: ... beta-catenin (BD Biosciences, 610153), Ki67 (BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... beta-catenin (610153, BD Biosciences), ZO-1 (40-2200 ...
-
bioRxiv - Microbiology 2022Quote: ... Purified mouse anti-human IRF-3 (BD PharMingen, San Diego, CA) was used at a dilution of 1:100 ...
-
bioRxiv - Biochemistry 2021Quote: ... beta-actin (BD Biosciences #612656, RRID:AB_2289199), GAPDH (CST #2118 ...
-
bioRxiv - Cell Biology 2020Quote: ... Integrin Beta 4 (1:100, BD), Lrig1(1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... beta-tublin-488 (BD Pharmingen; 560338).
-
bioRxiv - Cancer Biology 2022Quote: ... and mouse anti-human LAG-3 conjugated to BV421 (BD Biosciences, 565721). Antibodies used for mouse cells are rat anti-mouse CD8a conjugated to FITC (BioLegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... human PBMCs (3×105 cells/condition) were incubated with CD8 (BD, 562428), CD25 (BD ...
-
bioRxiv - Cell Biology 2022Quote: ... beta-catenin mouse (1:200 BD 610154), CD31 rat (1:100 BD 550274) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-integrin beta 1 (BD Biosciences 555002), anti-talin (Sigma-Aldrich T3287) ...
-
bioRxiv - Immunology 2021Quote: ... Beta-RBD with BUV661-streptavidin (BD Biosciences), and Delta RBD with PE-streptavidin (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse Anti-beta Catenin (1:1,000, BD Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... beta-catenin 1:2000 (610153; BD Biosciences). Donkey anti-rabbit IgG (H+L ...
-
bioRxiv - Cancer Biology 2021Quote: ... and BV421 mouse anti-human CD366 (TIM-3) (1:100; 565562, BD Biosciences).
-
bioRxiv - Cell Biology 2023Quote: ... 3 x 106 BM cells were incubated with human Fc BlockTM (BD, 564219) for 10 minutes at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... Panel #3 included anti-human CD8 BUV396 (RPA-T8, BD Biosciences, 1:20), CD20 BUV737 (L27 ...
-
bioRxiv - Cancer Biology 2024Quote: ... FITC Mouse Anti-Human MRP1 antibody (BD Biosciences, clone QCRL-3, cat#557593). Then cells were washed with PBS and analyzed by flow cytometry ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-beta-catenin (BD 610154, 1:1000), mouse anti-hospho-SAPK/JNK (Thr183/Tyr185 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primary antibody to beta catenin was obtained from BD Transduction Laboratories (Catalog #610153) ...
-
bioRxiv - Bioengineering 2024Quote: ... or anti-human/mouse phospho-SMAD2/3-AF647 (clone 072-670, BD Biosciences, 1:100) in antibody staining buffer (1X PBS ...
-
bioRxiv - Biophysics 2021Quote: ... and incubated with anti-beta-II spectrin primary antibody (BD Biosciences ...
-
bioRxiv - Genetics 2022Quote: ... and dissected with a pair of 25G 5/8” needles (PrecisionGlide from BD) by cutting at the pharynx and/or at the tail ...
-
bioRxiv - Neuroscience 2023Quote: ... we considered each possible pair of stimuli (AB, AC, AD, BC, BD, CD) separately ...
-
bioRxiv - Microbiology 2024Quote: ... Constructs pairs including empty vectors (AD-fusion + empty BD, or empty AD + BD-fusion) were tested first to evaluate the capacity of each protein of interest to transactivate the HIS3 reporter gene in the absence of interactor ...
-
bioRxiv - Microbiology 2024Quote: ... Constructs pairs including empty vectors (AD-fusion + empty BD, or empty AD + BD-fusion) were tested first to evaluate the capacity of each protein of interest to transactivate the HIS3 reporter gene in the absence of interactor ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Beta Tubulin Class III (clone Tuj1, 15 μl, BD Biosciences).
-
bioRxiv - Biophysics 2022Quote: ... the cells were stained with beta-1 integrin antibody (HUTS21, BD Bio-sciences) or mouse anti-human β1 integrin P5D2 (Developmental studies Hybridoma bank)” ...
-
bioRxiv - Cell Biology 2023Quote: ... worms were incised with a pair of 30G 5/8” needles (PrecisionGlide, BD, Franklin Lakes, NJ) near the anus ...
-
bioRxiv - Neuroscience 2020Quote: ... and all membranes were probed with anti-beta-adaptin antibody (1:1000, BD Transduction) and GluA1 or HA antibody to control for amount precipitated.
-
bioRxiv - Immunology 2020Quote: ... followed by staining for 3 days at 37 °C with 1:100 dilutions of BV421-labeled mouse anti-human CD35 clone E11 (BD Biosciences) and Alexa Fluor 488-labeled mouse anti-Ki67 clone B56 (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... and 1:20 dilution mouse anti-human CD123 (IL-3)-PE (stock 200 ug/mL, BD Biosciences, Franklin Lakes, NJ, USA). A 1:1,000 dilution of anti-mouse IgG Alexa-647 (stock 1 mg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were activated for 3 days with 1 μg/mL/million cells of purified NA/LE mouse anti-human CD3 and CD28 (BD Biosciences) and infected with HIVBaL at 0.01 ng/106 cells ...
-
bioRxiv - Microbiology 2022Quote: ... IL-6 and TGF-beta1 was quantified in serum from immunized and non-immunized mice using the CBA (cy-tometric beads array -BD™) method ...
-
bioRxiv - Immunology 2021Quote: ... Interferon γ (IFNγ) in the culture supernatants was measured by ELISA using commercially available antibody pairs (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... anti-TCR-beta chain (H57-597) and anti-TCR-gamma-delta (GL3) were from BD Horizon ...
-
bioRxiv - Bioengineering 2021Quote: IHC staining was performed as previously described42 using beta-catenin antibody (BD, 610154, 1:100) or HA tag (CST ...
-
bioRxiv - Immunology 2023Quote: ... anti-TCR-beta chain (H57-597) and anti-TCR-gamma-delta (GL3) were from BD Horizon ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-human CD44 or anti-human CD59 (BD Pharmingen) or 5μg/ml Biotin-Tfn (Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... and the supernatants were harvested for cytokine detection (IL-10 and TGF-β) by specific ELISAs using a standard protocol (BD OptEIA). The detection limits for IL-10 is 31.3–2000 pg/ml e TGF- β is 62.5–4,000 pg/mL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... IFN-γ and TGF-β in mouse serum was performed with the BD OptEIATM Mouse IL-10 ELISA Set (BD Biosciences, 555252), BD OptEIATM Mouse TNF (Mono/Mono ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Immunology 2023Quote: ... with our custom-designed primer panel (BD Biosciences), comprising 98 additional genes (Table S2 ...