Labshake search
Citations for Becton, Dickinson and Company :
451 - 500 of 3659 citations for Glutathione Fluorescent 384 Well Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis assay was performed using the FITC Annexin V Apoptosis Detection Kit [(#556547, BD Biosciences, NJ, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1×105 cells were stained using PE Annexin V Apoptosis Detection Kit I (BD Biosciences, Cat # 559763) following to the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Assay was adapted from manufacturer directions of the FITC Annexin V Apoptosis Detection Kit (BD Pharmingen, 556547). In brief ...
-
bioRxiv - Immunology 2022Quote: ... The apoptosis of cells was stained with PE Annexin V Apoptosis Detection Kit (BD Biosciences, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Apoptotic cells in leukemic spleens were quantified with PE-AnnexinV Apoptosis Detection Kit I (BD Pharmingen, 559763). All flow cytometry data was collected on an Attune NxT Flow Cytometer (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were collected as above and stained using propidium iodide (FITC Annexin V Apoptosis Detection Kit; BD) and APC Annexin V (BD) ...
-
bioRxiv - Microbiology 2024Quote: ... Two separate AK Agar #2 plates (Sporulating Agar) (BD, cat. No. 210912, Franklin Lakes, NJ) were spread-plated with 100 µl of overnight culture and incubated at 30°C for 5 days ...
-
bioRxiv - Cancer Biology 2019Quote: ... 24-well transwell units were pre-coated with 2 mg/mL BD Matrigel® (BD Biosciences), and incubated at 37oC for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Physiology 2022Quote: Primary mouse hepatocytes were cultured in BD BioCoat™Collagen 6-well plates (BD Pharmingen, Franklin Lakes, NJ, USA) at 1-1.5 x 106 cells per well in William’s medium (catalog n°12551032 ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Cancer Biology 2019Quote: ... populations of knockout (or control) cells were FACS sorted as single cells in 96-well plates (BD FACSAria II) and allowed to grow for approximately 2 weeks ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...
-
bioRxiv - Neuroscience 2019Quote: ... Rat hippocampal cells were plated on poly-D lysine coated 96 well imaging plates (BD Biosciences, San Jose, CA) (~16 plates per week ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were sorted and cloned in 96-well culture plates using the BD FACSAria III (BD Biosciences). The isolated clones were screened by immunoblot and the mutations validated using the Surveyor® assay (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2020Quote: ... CD19+ Pf+ or HA+ B cells were single cell–sorted into 96-well plates using a FACSAria II (BD). Index sorting was used to determine isotype and B cell subsets by IgM ...
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed with PBS prior to the addition of 100 μL/well TMB substrate (BD Biosciences). Fifteen minutes after the addition of substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... The bone marrow cells were plated onto a 100 mm culture dis h or six-well plate (BD Biosciences) coated with 0.01% poly-D-lysine and cultured in DME M supplemented with 1% penicillin/streptomycin and 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... viable cells were dispensed at different densities in 96-well plates by fluorescence-activated cell sorting (FACS Aria, BD). When required ...
-
bioRxiv - Immunology 2021Quote: ... Single cell sorting was done on 96-well plates using a FACS Aria II (BD Biosciences, Franklin Lakes, NJ) in the Biomedical Research Facilities Core at the University of Michigan.
-
bioRxiv - Immunology 2021Quote: ... cells were resuspended in enzyme-free ethylenediaminetetraacetic acid (EDTA) buffer and replated in untreated 6-well plates (BD Falcon) at 1 M cells per well in unconditioned medium ±25 U/ml IFN-γ (Peprotech ...
-
bioRxiv - Cancer Biology 2022Quote: ... Stained samples were analyzed using single-color compensation on a Sony SP6800 spectral analyzer or Beckman Coulter CytoFLEX LX 96-well plate system and quantified using FlowJo V10.8.1 (BD Biosciences).
-
bioRxiv - Cell Biology 2022Quote: ... and single cells were sorted by FACS into 96-well plates using a FACSAria III cell sorter (BD Biosciences) to obtain single-cell-derived clones ...
-
bioRxiv - Immunology 2022Quote: Mouse thioglycollate-elicited PECs and mouse BM-Mphs were cultured in flat-bottom 96-well plates (BD Falcon, USA) at 1 × 105 cells/well ...
-
bioRxiv - Cell Biology 2023Quote: ... single GFP-positive cells were sorted into 96-well plates using a DiVa fluorescence-activated cell sorter (BD Biosciences) at the Duke Cancer Institute Flow Cytometry Shared Resource ...
-
bioRxiv - Microbiology 2023Quote: ... T-cells were transferred to a 96 well plate after co-culturing and surface staining of CD8 (BD Biosciences) was performed ...
-
bioRxiv - Cancer Biology 2023Quote: Matrigel-coated (invasion) 8 μm pore size translucent 24-well plate transwell chambers (BD Biosciences, San Jose, CA, USA) were used to evaluate the migration and invasion potential of melanoma cells cultured in different conditions ...
-
bioRxiv - Genomics 2023Quote: ... and single isolated nuclei (0.1% NP-40 substitute lysis buffer48 were sorted into 96-well plates using the BD FACSMelody and BD Fusion cell sorter ...
-
bioRxiv - Genomics 2023Quote: ... and single isolated nuclei (0.1% NP-40 substitute lysis buffer48 were sorted into 96-well plates using the BD FACSMelody and BD Fusion cell sorter ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP-positive single cells were isolated and sorted into 96-well plates by FACS Aria cell sorter (BD Biosciences). Cells were maintained in 96-well plates until they reached confluence and then expanded into larger plates for further analysis ...
-
bioRxiv - Bioengineering 2023Quote: ... labeled wild-type HUVECs in a 1:1 ratio and seeded at a final density of 7.5 X 104 in 24-well plates coated with collagen 1 (from rat tail, BD). After culturing for 48h in complete medium at 37°C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were sorted after another 48 h into 96-well plates using a BD FACSMelody Cell Sorter (BD Biosciences). Targeted knock-in of the 24xMS2 stem loops was confirmed by locus- and knock-in-specific PCR ...
-
bioRxiv - Immunology 2023Quote: ... Plates were washed six times with PBS-tween and developed by adding 50 μl/well of tetramethylbenzidine substrate (BD), with reaction stopped using 1.5M H2SO4 ...
-
bioRxiv - Genomics 2021Quote: ... and calibrated using Accudrop fluorescent beads (BD Biosciences). A single cell from the Calcein AM-positive ...
-
bioRxiv - Immunology 2020Quote: Fluorescent dye–conjugated antibodies were purchased from BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: Fluorescent dye–conjugated antibodies were purchased from BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: Fluorescent-dye-conjugated antibodies were purchased from BD Biosciences (USA ...
-
bioRxiv - Bioengineering 2022Quote: ... then GFP-fluorescent cells were sorted by BD FACSAria™ IIIu (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: Fluorescent dye–conjugated antibodies were purchased from BD Biosciences ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were stained by using the PE Annexin V Apoptosis Detection Kit I according to manufacturer’s protocol (BD). Flow cytometry was performed on an LSR II flow cytometer (BD ...
-
bioRxiv - Cancer Biology 2020Quote: Cellular apoptosis was measured with FITC Annexin V Apoptosis Detection Kit I (BD Pharmingen, San Diego, CA, USA) as per as manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: Viability of γδ T cells was assessed using the FITC Annexin V Apoptosis Detection Kit I (BD Bioscience).
-
bioRxiv - Cancer Biology 2019Quote: ... Cell death induction of macrophages upon MEKi treatment was evaluated using Annexin V Apoptosis Detection Kit (BD Biosciences). Polarized macrophages were incubated with or without 10 nM or 20 nM trametinib or with respective volume of DMSO (0.1 % v/v ...
-
bioRxiv - Molecular Biology 2020Quote: Apoptosis analysis was based on FITC Annexin-V Apoptosis Detection Kit protocol (BD Biosciences, San Jose, CA, USA). Briefly ...
-
bioRxiv - Immunology 2022Quote: Detection of IL8/CXCL8 in culture supernatants was performed using the OptEIA Human IL-8 kit (BD Biosciences), according to manufacturer’s instruction.
-
bioRxiv - Neuroscience 2023Quote: Apoptosis and necrosis cell quantity was measured using the FITC/Annexin V Apoptosis Detection Assay Kit I (BD Biosciences Pharmingen ...
-
bioRxiv - Cancer Biology 2023Quote: ... trypsinized (supernatants were kept) and stained with a FITC-Annexin-V/PI apoptosis detection kit (BD Pharmigen #556547) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were stained using the FITC Annexin V Apoptosis Detection Kit I (BD Pharmingen™, NJ, USA).