Labshake search
Citations for Becton, Dickinson and Company :
601 - 650 of 3264 citations for DHEA S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Fertilized eggs were placed in 6-well plates (BD Falcon, Corning) with 40 embryos per well/group in 4 mL of filtered sea water and kept in an incubator at 18°C ...
-
bioRxiv - Genomics 2022Quote: ... and on Chocolate II Agar plates (BD, cat# 22126, MD, USA) at 37°C in 5%CO2 for 24 h.
-
bioRxiv - Microbiology 2022Quote: ... M9 or M8 medium plates solidified with 1% Bacto agar (BD) and excess liquid was removed with a pipette ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Phage plates are prepared with 1g/L Yeast Extract (BD-241750), 10 g/L Bacto-Tryptone (Fischer-BP1421) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Phage plates are prepared with 1g/L Yeast Extract (BD-241750), 10 g/L Bacto-Tryptone (Fischer-BP1421) ...
-
bioRxiv - Immunology 2023Quote: Lung lymphocytes were seeded into 96-well flat bottom plates (BD) at 106 cells in 200 uL/well ...
-
bioRxiv - Immunology 2023Quote: ... Plates were washed and OptEIA TMB substrate (BD Biosciences Cat # 555214) was applied for 8 ...
-
bioRxiv - Immunology 2023Quote: ... XF 96-well plates were coated using Cell-Tak (BD Biosciences) according to the Seahorse protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 293TACE2 cells were seeded onto 384 well plates (BD Falcon, 353962) and incubated overnight ...
-
bioRxiv - Microbiology 2023Quote: ... MHII plates were made from MHII broth (212322) obtained from BD. Glucose (41095-5000 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The assays were performed in TSBGM plates containing 0.3% agar (BD) and the diameter of the strains was measured after 24 hours of growth at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: Cells were seeded in a 96-well imaging plate (BD Falcon) 24 h prior fixation ...
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μl of this suspension (1×10e5) was transferred to a 5 ml culture tube and 5 μl of FITC Annexin V (BD Biosciences) added ...
-
bioRxiv - Developmental Biology 2024Quote: All cell culture of all species was maintained at 37°C with 5% CO2 and 5% O2 on Matrigel (1:100, BD Corning) coated plates unless otherwise specified ...
-
bioRxiv - Cell Biology 2019Quote: ... The inner well of assembled stretch chambers was ozone-activated for 30 s via corona arc-discharge (BD-20, Electro-Technic Products Inc.) and coated with 50 µg/ml bovine plasma fibronectin (F1141 ...
-
bioRxiv - Plant Biology 2022Quote: ... 9 cm Petri plates on modified Hoagland’ s medium (Baskin and Wilson, 1997) containing 1% w/v sucrose and 1% w/v agar (Difco Bacto ager, BD laboratories; http://www.bd.com). Two days after stratification at 4°C in the dark ...
-
bioRxiv - Immunology 2019Quote: ... Serum was collected by tail-tipping before LPS injection and 2 and 4 hours following injection for IL6 determination by ELISA (BD; OptEIATM Set Mouse IL-6), as per manufactures instructions.
-
bioRxiv - Microbiology 2020Quote: ... and mIL-2 was measured by ELISA using the capture Ab JES6-1A12 and the biotinylated detection Ab JES6-5H4 at 450 nm (BD Pharmingen™; San Diego, USA). Experiments were performed in triplicate.
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Bioengineering 2019Quote: ... containing 5% (vol/vol) Nu-Serum I (BD Biosciences), 1% ITS+ Premix (BD Biosciences) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Microbiology 2019Quote: ... from Biolegend and CD4-Alexa Fluor 700 (RM4-5) from BD Biosciences ...
-
bioRxiv - Immunology 2019Quote: ... 5 μl of 7-AAD (BD Pharmingen, ref 559925) were added on cells 10 minutes before flow cytometry analysis ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Microbiology 2022Quote: ... 5 times with a 1 mL syringe (BD, Spain). This was the control sample.
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Immunology 2020Quote: ... CD38-FITC 1:5 (clone HIT2, BD Biosciences, 560982), and SARS-CoV-S1-CF647 at 1 µg/ml for patients CV07 ...
-
bioRxiv - Microbiology 2022Quote: ... CD64 Brilliant Violet 786 (X54-5/7.1, BD Bioscience), MHC-II I-A/I-E Pacific Blue (M5/114.15.2) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was blocked in 5% skimmed milk (BD) and probed with rabbit polyclonal antibody against Gαq ...
-
bioRxiv - Genomics 2022Quote: ... 5 g Bacto™ peptone (BD, Cat. No.: 9030688), 1 g Bacto™ yeast extract (BD ...
-
bioRxiv - Immunology 2022Quote: ... and CD4–PerCP-Cy5.5 (clone R4-5; BD Biosciences). For intercellular staining ...