Labshake search
Citations for Becton, Dickinson and Company :
401 - 450 of 5513 citations for Chicken Caveolin 1 CAV1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... CtBP1 (1:1,000, BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... αLy6C (1:300; BD Biosciences Cat# 563011 ...
-
bioRxiv - Immunology 2023Quote: ... αCD8a (1:300; BD Biosciences Cat# 741811 ...
-
bioRxiv - Cell Biology 2023Quote: ... Flottilin-1 (BD; 610820); FLAG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Calcineurin (1:1000; BD Bioscience ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin (1:5000, BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... αCD11b (1:800; BD Biosciences Cat# 612801 ...
-
bioRxiv - Immunology 2023Quote: ... αSiglecF (1:300; BD Biosciences Cat# 746668 ...
-
bioRxiv - Immunology 2023Quote: ... αCD11c(1:300; BD Biosciences Cat# 564080 ...
-
bioRxiv - Neuroscience 2023Quote: ... CtBP2 (1:1000, BD Biosciences Cat# 612044 ...
-
bioRxiv - Cancer Biology 2023Quote: ... CtBP2 (1:1000, BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fibronectin (1:1000, BD) and GAPDH (1:5000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... CD43 (1:200, BD Pharmingen 562865 ...
-
bioRxiv - Immunology 2024Quote: ... PD-1 (MIH4, BD). LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (Thermo Fisher ...
-
bioRxiv - Bioengineering 2020Quote: ... at 5:1:1 concentration ratio before transferred into a 1 ml syringe with BD Luer-Lok (BD, 309628, NJ, USA). The syringe was then hanged vertically to allow cell settling by gravity for 10-15 min with no flow ...
-
bioRxiv - Neuroscience 2020Quote: ... one section out of ten was incubated with BrdU antibodies (BrdU, 1/1,000, CldU, 1/500, Accurate Chemical; IdU, 1/500, BD Bioscience). Bound antibodies were visualized with Cy3-goat anti-rat antibodies (1/1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... were grown in in Pro99 media supplemented with 5 g L-1 peptone and 1 g L-1 yeast extract (BD Difco). All heterotrophs were grown at 24 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... were subcutaneously inoculated with 1 × 106 LoVo or 2 × 106 LS180 cells in 1:1 mixture of PBS and matrigel (BD Biosciences) into lower right flank ...
-
bioRxiv - Immunology 2020Quote: ... A fixable Viability Dye (APC-eFluor780 1:200, 1:400) (eBioscience, Germany) or ViaProbe (7-AAD, 1:33) (BD Biosciences, Germany)) was used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... RORγt (AFKJS-9; PE, dil. 1:100) (eBioscience); CD25 (PC61; PerCP, dil. 1:400), CD103 (M290; PE, dil. 1:150) (BD Pharmingen); CD11b (M1/70 ...
-
bioRxiv - Pathology 2020Quote: ... KI67 (1/1000, 14-5698-82, Ebioscience), NANOG (1/200, 49035, cell signaling technology) and OCT3/4 (1/200, 561556, BD Biosciences). The next day ...
-
bioRxiv - Immunology 2019Quote: ... after which cells were stained with Fixable Viability Staining e780 (1:1000) and CD11B (M1/70) antibodies: CD11B-BV510 (Day 1 cells, 1:300, BD Biosciences), CD11B-Percp-Cy5.5 (Day 3 cells ...
-
bioRxiv - Immunology 2021Quote: ... as a negative control in the presence of αCD28/αCD49d co-Stim antibodies (1 μg ml−1) GolgiStop (containing Monensin, 2 μmol/L), GolgiPlug (containing brefeldin A, 10 μg ml−1) (BD Biosciences) and anti-CD107α BV421 antibody (BD Biosciences) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 x 106 parasites were collected and incubated with VSG2WT antisera (1:4000) or VSG11WT (1:1000) together with Fc block (1:200, BD Pharmingen) in cold HMI-9 without FBS for 10 min at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... The cOBBs were resuspended in 1:1 v/v ECM gel to cOBBs and transferred to a 1 mL disposable syringe (BD Biosciences). The cOBBs were centrifuged at 100g for 3 min and the supernatant removed ...
-
bioRxiv - Cancer Biology 2024Quote: ... bilateral subcutaneous dorsal flank tumors were established by injecting 1 × 106 cells suspended in a 1:1 mixture of serum-free medium and Matrigel (BD Biosciences). Once tumors reached an average volume of 100 mm3 ...
-
bioRxiv - Bioengineering 2024Quote: ... Viability dye was quenched by washing with FACS buffer (PBS + 2% FBS + 1 mM EDTA) before addition of surface staining antibodies in a 1:1 dilution of Brilliant Stain Buffer (BD 563794) in FACS buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... and stained for 30 min on ice with surface antibodies at a 1:200 dilution in a 1:1 mixture of FACS buffer and Brilliant Stain Buffer (BD Biosciences). Cells were washed with FACS buffer and PBS and fixed with 2% paraformaldehyde on ice for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies (anti-Cas9 7A9-3A3, Cell Signaling Technology #14697S, anti-γ-tubulin Sigma#T5326, anti-Human Retinoblastoma protein BD Pharmigen #554136 ...
-
bioRxiv - Cell Biology 2021Quote: ... conjugated anti-c-kit and Peridinin Chlorophyll Protein Complex (PerCP) or allophycocyanin (APC) conjugated anti-CD45 antibodies were purchased from BD Biosciences Pharmingen ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...