Labshake search
Citations for Becton, Dickinson and Company :
501 - 550 of 5069 citations for Calcium calmodulin Dependent 3' 5' Cyclic Nucleotide Phosphodiesterase 1C PDE1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... HRP activity was further revealed using 3-amino-9-ethylcarbazole (BD Biosciences) for 8 min at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit polyclonal anti-active Caspase-3 (1:100 dilution, BD Biosciences BDB559565), rabbit polyclonal anti-influenza A virus M2 (1:100 dilution ...
-
bioRxiv - Genomics 2019Quote: ... A custom-made syringe catheter (consisted of 3-ml syringe (BD #309657), Luer lock 26-gauge 1/2” dispensing needle (GraingerChoice #5FVG9) ...
-
Targeting MOG to skin macrophages prevents EAE in macaques through TGFβ-induced peripheral tolerancebioRxiv - Immunology 2019Quote: ... Cells were analyzed on a 3-laser LSR II flow cytometer (BD) with at least 105events collected ...
-
bioRxiv - Cancer Biology 2019Quote: ... and then washed 3 times with FACs buffer (BD Biosciences, Billerica, MA).
-
bioRxiv - Developmental Biology 2021Quote: ... and rabbit anti-activated Caspase-3 (Fisher Scientific/BD, BDB559565, 1:500). Antibody used for fluorescent in situ hybridization was mouse anti-Dig (Jackson ImmunoResearch 200-002-156 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse lung cryosections were stained overnight with anti-BrdU (1:3, BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... transwells were pre-coated with Matrigel (1:3 in DMEM, BD Biosciences), assays were performed with 1.5 × 104 cells plus 0.5 μg/μl mitomycin C for 72 h using 10 μg/ml collagen and 20% FBS as chemo-attractants ...
-
bioRxiv - Immunology 2022Quote: ... we added 3 μL of anti-CD123-APC (clone 7G3, BD Bioscience), 4 μL of anti-CD45-PE (clone HI30 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mouse anti-human LAG-3 conjugated to BV421 (BD Biosciences, 565721). Antibodies used for mouse cells are rat anti-mouse CD8a conjugated to FITC (BioLegend ...
-
bioRxiv - Immunology 2020Quote: ... Cleaved caspase-3 (Essen Bioscience, 4704) and CD45 (BD Pharmingen™, 553076) staining was performed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then stained with anti-cleaved caspase 3-PE (BD #550821) and anti-GATA1 (Abcam ab181544 ...
-
bioRxiv - Microbiology 2021Quote: ... The 3-amino-9-ethycabazole (AEC) substrate kit was purchased from BD Pharmingen.
-
bioRxiv - Immunology 2020Quote: ... Cells were exposed to anti-CD40 (1ug/ml, BD Clone HM40-3) and rIL-4 (10 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... Flow cytometry cell sorting was performed on an ARIA 3 (BD Biosciences) apparatus on single-cell suspensions from spleens or Peyer’s patches ...
-
bioRxiv - Cancer Biology 2022Quote: ... human PBMCs (3×105 cells/condition) were incubated with CD8 (BD, 562428), CD25 (BD ...
-
bioRxiv - Immunology 2022Quote: ... perflava was cultured on Gonococcal medium base (GCB, BD #DF0289-17-3) plus Kellogg’s supplements [63] at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... anti-Active Caspase 3 BV650 (1:200, clone C92-605, BD Biosciences); anti-BCL-xL PE (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... Data analysis was performed using FCAP Array software v.3 (BD Biosciences).
-
bioRxiv - Immunology 2024Quote: ... GATA-3 (TWAJ, eF660, eBioscience, or L50-829, PE-Cy7, BD Biosciences), T-bet (4B10 ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were washed and incubated with a fixing solution (1:3, BD Biosciences Cat# 554722 ...
-
bioRxiv - Microbiology 2024Quote: ... single colonies were inoculated into 3 ml Tryptic Soy Broth (TSB, BD) with 10 µg/ml chloramphenicol (Cm10 ...
-
bioRxiv - Immunology 2024Quote: ... was prepared and loaded into a 3 mL syringe (BD Biosciences, #309657). Primer-conjugated agarose was completely melted at 95°C for over 2 hours and subsequently loaded into a 3 mL syringe ...
-
bioRxiv - Cell Biology 2024Quote: ... then sort-matched for GFP using a FACSMelody 3-laser sorter (BD).
-
bioRxiv - Cancer Biology 2020Quote: ... Antibodies used for immunoprecipitations were mouse anti-ASCL1 antibodies (BD-Biosciences 556604) and normal mouse IgG (Santa Cruz Biotechnology sc-2025) ...
-
DJ-1 (Park7) affects the gut microbiome, metabolites and development of Innate Lymphoid cells (ILCs)bioRxiv - Immunology 2019Quote: ... Antibody staining was performed using α-Synuclein antibody (# 610786 BD Biosciences, Netherlands) for overnight (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used were as follows: anti-Paxillin and anti-GM130 antibodies (BD Transduction Laboratories ...
-
bioRxiv - Developmental Biology 2022Quote: ... stained with Epcam antibody (anti-CD326 antibody, BD Biosciences, # 563214, 1/500), and sorted for Epcam- and Epcam+ cells ...
-
bioRxiv - Genetics 2023Quote: Antibodies used for immunohistochemistry were as follows: anti-CtBP2/RIBEYE antibody (BD Transduction Laboratories #612044 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... HIF1α antibody (610958, BD). HRP-conjugated secondary antibodies were obtained from GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: ... CD107a-PE antibody (BD) was added into each well and incubated at 37°C for 4 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... N-cadherin antibody (BD Transduction Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... p62 antibody (#BD 610832), Lamp1 antibody (#BD 555798 ...
-
bioRxiv - Cell Biology 2021Quote: ... Lamp1 antibody (#BD 555798) and CD63 antibody (#BD 556019) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies were from BD Biosciences (www.bdbiosciences.com ...
-
bioRxiv - Cell Biology 2020Quote: ... STIM1 antibody from BD Transduction Laboratories (Franklin Lakes ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies are from BD Biosciences or BioXCell ...
-
bioRxiv - Cell Biology 2022Quote: ... CD24 antibody (BD Biosciences) and GtαMo AlexaFluor546 (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... Antibody capture beads (BD) were used for single-stain compensation controls ...
-
bioRxiv - Immunology 2023Quote: ... detection antibody (IFNγ, BD Biosciences #51-1818KA ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-paxillin antibody (BD Biosciences #610052 ...
-
bioRxiv - Neuroscience 2024Quote: ... (antibodies from BD Biosciences) and Rab5 (PE-CF594 ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...