Labshake search
Citations for Becton, Dickinson and Company :
301 - 350 of 6819 citations for 7H Diimidazo 1 5 a 1 5 4 de quinoxaline 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... IL-5 APC (clone TRFK5) (BD Cat. 554396). For examination of CD8+ population ...
-
bioRxiv - Immunology 2022Quote: ... Cd4 (RM4-5,BD Biosciences, Franklin Lakes, NJ), Cd103 (M290,Invitrogen-ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 μL of PI (BD Biosciences, USA) were sequentially added to a FACS tube followed by gently shaking and incubation for 15 min at room temperature in the dark ...
-
bioRxiv - Immunology 2020Quote: ... α5 (mouse 5H10-27, BD Pharmingen / human P1D6) (Wayner et al. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μg/mL GolgiStop (BD Biosciences, Cat # 554724) and anti-CD107a antibody (Clone H4A3 PE-Cy7 ...
-
bioRxiv - Microbiology 2019Quote: ... 5 g/L bacto yeast extract (BD, 212750) and 5 g/L sodium chloride (Merck ...
-
bioRxiv - Immunology 2019Quote: ... anti-CD4-BV786 (clone RM4-5, BD Horizon), anti-CD8α-FITC (clone 53-6.7 ...
-
bioRxiv - Immunology 2019Quote: ... and blocked with 5% skim milk (BD, # 232100) in TBST for 2 h at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... 5 g/L bacto Yeast extract (BD, 212750) and osmosed water supplemented with 0.46 μg/L MgCl2 ...
-
bioRxiv - Physiology 2021Quote: ... resuspended in 5 μL of 25% Matrigel (BD) - PBS ...
-
bioRxiv - Immunology 2020Quote: ... in a 5-ml round tube (BD Biosciences) for 30 minutes at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... CD4 BUV737 (BD, clone RM4-5, cat 565246), CD8 PerCP-Cy5.5 (Biolegend ...
-
bioRxiv - Microbiology 2020Quote: ... in 5 ml volume of CA-MHB (BD). The same procedure was performed with eight 300 UI polymyxin B disks (Oxoid ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μg Human BD FCBlock (BD Biosciences). The following conjugated mouse anti-human monoclonal antibodies (mAbs ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μg Human BD FCBlock (BD Biosciences). The following mouse anti-human conjugated mAbs were used to detect extracellular markers on B-cells ...
-
bioRxiv - Immunology 2022Quote: ... anti–CD4-PerCpCy5.5 (Clone RM4-5, BD Biosciences), and anti–CD8-APC-H7 (Clone 53-6.7 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 g/L Difco Yeast Extract (BD 210929), 1.15 g/L citric acid (Sigma-Aldrich C0759) ...
-
bioRxiv - Genomics 2022Quote: ... anti-CD11b-V450(BD Bioscience Clone: WT.5), anti-CD11a-PE (BD Bioscience Clone ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μl of anti-CD45-APC (BD Biosciences), and 5 μl of anti-CD326 (EpCAM)-PE-Cy7 (Biolegend ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD4 BUV805 (BD Bioscience; clone: RM4-5), anti-CD8 BV421 (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD4 FITC (BD Biosciences, clone RM4-5) and anti-CD19 APC-Cy7 (BD Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was done with 5% skim milk (BD) in TBST (TBS+0.1% Tween-20) ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-APC (BD Bioscience, X54-5/7.1), Anti-F4/80-BV421 (Biolegend ...
-
bioRxiv - Systems Biology 2023Quote: ... anti–IFN-γ (5 µg/mL; BD Biosciences), and anti–IL-12 (5 µg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μl of anti-CD45-APC (BD Biosciences), and 5 μl of anti-CD326 (EPCAM)-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-AF647 (BD Pharmigen, X54-5/7.1), Anti-Siglec-F-PE (BD Pharmigen ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µg/ml anti-ITGB1 (BD Bioscience) in BMMC culture media at 37°C and 5% CO2 for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), and anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Systems Biology 2019Quote: ... Membranes were incubated with primary antibody solutions (using 5% milk or BSA in TBST) overnight at 4°C at the respective dilutions: E-Cadherin (BD, #610181,1:5000), Vimentin (Abcam ...
-
bioRxiv - Immunology 2019Quote: Cells were harvested by centrifugation at 400 g for 5 minutes at 4°C followed by staining with fixable viability stain (BD Horizon FVS700) for 10 minutes on ice in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were then washed with flow cytometry buffer [PBS + 0.5% Bovine Serum Albumin (BSA) (Fisher BioReagents, BP9706100) + 2 mM EDTA] and incubated at 4°C with Fc Block (BD Biosciences, 553142) for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... and several ten-fold dilutions (10−4 to 10−7) were plated onto de Man Rogosa and Sharpe (MRS) media (BD Difco, USA) supplemented with 50 mg/L of mupirocin (PanReac AppliChem ...
-
bioRxiv - Cell Biology 2019Quote: ... The following day they were probed with antibodies to FLAP (Novus, IMG 3160, 1:100) and to 5-LO (BD Biosciences, 610695, RRID: AB_398018). Secondary antibodies were applied at 3 µg/mL for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... 1.5 µg/mL) [31] in the presence of anti-CD28 and anti-CD49d antibodies (both at 1 μg/ml, BD, Franklin Lakes, New Jersey) and brefeldin-A (10 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... CD10-BUV395 (BD, Le Pont de Claix, France); CRTH2-FITC ...
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Microbiology 2022Quote: ... 98 mL of fresh MRS medium is then inoculated with 2 mL of the overnight culture and incubated at 37°C without shaking to an OD of 0.5-0.6 (ca. 4-5 hours) in a GasPak anaerobic jar (BD GasPak™ EZ container systems). Cells are harvested a first time by centrifugation at 4,000 g for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell suspensions were blocked for 5 min at 4 °C with rat anti-mouse CD16/CD32 (#553142, Mouse BD Fc Block, BD Biosciences) in FACS buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-Oct3/4 human isoform A (BD Biosciences, 561628, 1:40) and rabbit anti-Phospho-Histone H2A.X (CST ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole) solution (BD Pharmingen, 564907, 1:2000) was added to the secondary antibodies for nuclear staining ...
-
bioRxiv - Immunology 2022Quote: Synovial tissue was fixed in 1:4 dilution Fixation/Permeabilization solution (BD Biosciences Cytofix/Cytoperm Cat No ...