Labshake search
Citations for Becton, Dickinson and Company :
501 - 550 of 7994 citations for 7 Methyl 1 5 dioxo 1 2 3 5 tetrahydro indolizine 6 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Brains were dissected and dehydrated next day and were washed 3 times in PDT buffer (0.3 Triton-X in PBST with 1% DMSO) and incubated with Caspase-3 antibody (1:500; BD Biosciences) at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... the following antibodies were used (volume per 1×10^6 cells): CD45RA FITC (5μl, BD), CD49f PE-Cy5 (3.5μl ...
-
bioRxiv - Microbiology 2021Quote: ... or a 1.6X BD FACS™ Lysis Solution (1:6 in sterile dH2O; BD Biosciences) for the indicated time points at RT ...
-
bioRxiv - Cancer Biology 2024Quote: NF1-proficient and NF1-deficient engineered clones were injected into the flanks of 6- to 7-week-old athymic nude mice (1.0×106 cells) in 50% Matrigel (BD Biosciences). Mice were monitored for tumor formation for 6 months post injection or until a tumor volume of 2000mm3 was reached.
-
bioRxiv - Immunology 2022Quote: ... 7-AAD (7-aminoactinomycin D, cat# 559925, BD Pharmingen) was added at 1/250th v/v ...
-
bioRxiv - Immunology 2019Quote: ... 7-AAD (7-amino-actinomycin D) 0.5mg/L (BDbiosciences)or DAPI 1mg/L were used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... Viable 7-aminoactinomycin-D-excluding (7-AAD; BD Pharmingen) CD3-APC+ (eBioscience ...
-
bioRxiv - Immunology 2022Quote: ... and 7-amino-actinomycin D (7-AAD; BD Biosciences) to detect dead cells ...
-
bioRxiv - Bioengineering 2023Quote: ... pneumoniae serotype 3 (Sp3) (ATCC; Manassas, VA) was cultured on plates of BBL Trypticase Soy Agar with 5% sheep blood (BD Trypticase Soy Agar II) (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... ELISA anti-mouse IL-2 and IL-6 sets were from BD Biosciences.
-
bioRxiv - Microbiology 2023Quote: ... We then create a 1 mm thick sheet of agarose using a 3 mL syringe (BD, 3 mL Luer lock) and a blunt needle (Industrial Dispensing Supplies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and BV421 mouse anti-human CD366 (TIM-3) (1:100; 565562, BD Biosciences).
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were incubated overnight in 1:3 diluted cytofix in PBS (BD 554655) at 4 degrees Celsius with agitation ...
-
bioRxiv - Bioengineering 2021Quote: ... Sections were incubated with rabbit anti-active caspase-3 (1:40, BD, 559565) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Caspase-3 monoclonal antibody (1:500, clone C92-605; BD Biosciences), Click-iT Tunel Alexa Fluor 647 (1:500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2023Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Bioengineering 2019Quote: ... containing 5% (vol/vol) Nu-Serum I (BD Biosciences), 1% ITS+ Premix (BD Biosciences) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Microbiology 2019Quote: ... from Biolegend and CD4-Alexa Fluor 700 (RM4-5) from BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Microbiology 2022Quote: ... CD64 Brilliant Violet 786 (X54-5/7.1, BD Bioscience), MHC-II I-A/I-E Pacific Blue (M5/114.15.2) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was blocked in 5% skimmed milk (BD) and probed with rabbit polyclonal antibody against Gαq ...
-
bioRxiv - Genomics 2022Quote: ... 5 g Bacto™ peptone (BD, Cat. No.: 9030688), 1 g Bacto™ yeast extract (BD ...
-
bioRxiv - Immunology 2022Quote: ... and CD4–PerCP-Cy5.5 (clone R4-5; BD Biosciences). For intercellular staining ...
-
bioRxiv - Microbiology 2022Quote: ... and 5% horse blood (BD, Franklin Lakes, New Jersey). Antibiotic susceptibility was determined using the bioMérieux Etest® platform (bioMérieux ...
-
bioRxiv - Immunology 2022Quote: ... anti-CD4-BV605 (BD Biosciences 563151: Clone: RM4-5), and anti-CD8a Super Bright 702 (Invitrogen 67-0081-82 ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked in 5% skim milk (BD), incubated 1 hour with primary mouse monoclonal antibody anti-HA tag (G036 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each membrane was blocked with 5% skim milk (BD) in TBST buffer (25 mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-CD4 (clone RM4-5, BD Bioscience, cat # BDB553043), anti-CD8 (clone 4SM15 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5 g/l Bacto yeast extract (BD Biosciences, UK), 10 g/l NaCl (Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... After blocking with 5% nonfat milk (BD Biosciences, USA) for 2h ...
-
bioRxiv - Immunology 2022Quote: ... anti-CD4-BV605 (BD Biosciences 563151: Clone: RM4-5), and anti-CD8a Super Bright 702 (Invitrogen 67-0081-82 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD2 PE (clone RM2-5, BD Pharmingen, RRID: AB_2073810), CD5 PE (clone 53-7.3 ...
-
bioRxiv - Microbiology 2023Quote: ... Bacto Yeast Extract (5 g/L; BD, Cat. # 212750), Glucose (2 g/L ...