Labshake search
Citations for Becton, Dickinson and Company :
401 - 450 of 1332 citations for 7 Cyano 5 fluoroindole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... in a 5-ml round tube (BD Biosciences) for 30 minutes at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... CD4 BUV737 (BD, clone RM4-5, cat 565246), CD8 PerCP-Cy5.5 (Biolegend ...
-
bioRxiv - Microbiology 2020Quote: ... in 5 ml volume of CA-MHB (BD). The same procedure was performed with eight 300 UI polymyxin B disks (Oxoid ...
-
bioRxiv - Immunology 2021Quote: ... pan-γδTCR-APC (1:5; B1; BD Biosciences), Vδ1-FITC (1:10 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μg Human BD FCBlock (BD Biosciences). The following conjugated mouse anti-human monoclonal antibodies (mAbs ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μg Human BD FCBlock (BD Biosciences). The following mouse anti-human conjugated mAbs were used to detect extracellular markers on B-cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... C (1:5, G46-2.6-FITC, BD Pharmingen), human CD45 (1:5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... human CD45 (1:5, HI30-APC, BD Pharmingen), human CD31 (1:800 ...
-
bioRxiv - Immunology 2022Quote: ... anti–CD4-PerCpCy5.5 (Clone RM4-5, BD Biosciences), and anti–CD8-APC-H7 (Clone 53-6.7 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 g/L Difco Yeast Extract (BD 210929), 1.15 g/L citric acid (Sigma-Aldrich C0759) ...
-
bioRxiv - Genomics 2022Quote: ... anti-CD11b-V450(BD Bioscience Clone: WT.5), anti-CD11a-PE (BD Bioscience Clone ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μl of anti-CD45-APC (BD Biosciences), and 5 μl of anti-CD326 (EpCAM)-PE-Cy7 (Biolegend ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD4 BUV805 (BD Bioscience; clone: RM4-5), anti-CD8 BV421 (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD4 FITC (BD Biosciences, clone RM4-5) and anti-CD19 APC-Cy7 (BD Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was done with 5% skim milk (BD) in TBST (TBS+0.1% Tween-20) ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-APC (BD Bioscience, X54-5/7.1), Anti-F4/80-BV421 (Biolegend ...
-
bioRxiv - Systems Biology 2023Quote: ... anti–IFN-γ (5 µg/mL; BD Biosciences), and anti–IL-12 (5 µg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μl of anti-CD45-APC (BD Biosciences), and 5 μl of anti-CD326 (EPCAM)-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Systems Biology 2023Quote: ... anti–IL-4 (5 µg/mL; BD Biosciences); Th2 cells ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-AF647 (BD Pharmigen, X54-5/7.1), Anti-Siglec-F-PE (BD Pharmigen ...
-
bioRxiv - Molecular Biology 2024Quote: ... positive and CD45 (BD Biosciences, 555483, 1/5) negative MSC population (Giuliani et al. ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µg/ml anti-ITGB1 (BD Bioscience) in BMMC culture media at 37°C and 5% CO2 for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), and anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μl of this suspension (1×10e5) was transferred to a 5 ml culture tube and 5 μl of FITC Annexin V (BD Biosciences) added ...
-
bioRxiv - Developmental Biology 2024Quote: All cell culture of all species was maintained at 37°C with 5% CO2 and 5% O2 on Matrigel (1:100, BD Corning) coated plates unless otherwise specified ...
-
bioRxiv - Biochemistry 2019Quote: ... After 6 or 7 days cells were resuspended in enzyme-free EDTA buffer and replated in untreated 6-well plates (BD Falcon, Sigma-Aldrich) at 1 M cells per well in unconditioned medium with or without priming in 25 U IFN-γ (PeproTech ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1uM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilization step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... α7 integrin-PE antibody (AbLab, Vancouver, Canada), CD9-APC antibody (eBioscience, San Diego, CA) and CD47-BV605 antibody (BD Biosciences, San Jose, CA) for 30 minutes on ice and washed ...
-
bioRxiv - Cancer Biology 2019Quote: ... For apoptosis analysis was performed by a double staining Annexin V and 7-AAD Apoptosis Detection Kit (BD Pharmingen, San Jose, CA, USA) following the manufacture’s introductions ...
-
bioRxiv - Immunology 2020Quote: ... 7 days post-vaccination) and measured Cytokines using the BD CBA Mouse Th1/Th2/Th17 Cytokine Kit (BD Bioscience, San Jose, CA, USA). Sera samples were processed as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Bioengineering 2019Quote: ... containing 5% (vol/vol) Nu-Serum I (BD Biosciences), 1% ITS+ Premix (BD Biosciences) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Microbiology 2019Quote: ... from Biolegend and CD4-Alexa Fluor 700 (RM4-5) from BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...