Labshake search
Citations for Becton, Dickinson and Company :
301 - 350 of 1399 citations for 6 Isoquinolinamine 5 propyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), and anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6×108 cells were fixed with 30 ml BD Phosflow™ Fix Buffer I (BD Biosciences) for 20 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: iTF-Microglia were treated for 6 h with 1:2000 GolgiPlug™ (BD; Cat. No. 555029) or DMSO as control before dissociating ...
-
bioRxiv - Genomics 2021Quote: ... Cells were briefly stained with 4′,6-diamidino-2-phenylindole (DAPI) before using flow cytometry (BD FACS Aria ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were seeded onto collagen I-coated 6-well tissue culture plates (BD biosciences #346400) in packaging medium (DMEM (Thermo Fisher #11965) ...
-
bioRxiv - Molecular Biology 2022Quote: The following antibodies were used for immunofluorescence experiments: mouse anti-TIAR (Clone 6; 610352, BD Biosciences), rabbit anti-YTHDF2 (24744-1-AP ...
-
bioRxiv - Microbiology 2020Quote: ... 6 and 8 hours after infection by flow cytometry using a FACS Aria III (BD Biosciences). The intensity of GFP fluorescence corresponds to the amount of intracellular bacteria ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-α-6 integrin-PE (GoH3) and anti-CD117 (c-KIT)-APC (2B8) antibodies (BD Pharmingen). For purification of undifferentiated spermatogonia ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (2.5 ml) was added to 6-well plates (BD Biosciences Inc., Franklin Lakes, NJ), and allowed to solidify ...
-
bioRxiv - Genomics 2021Quote: ... and a PE-conjugated Mouse Anti-Human HLA-DR antibody (BD Biosciences 555812, clone G46-6). Data were analyzed in FlowJo (FlowJo LLC ...
-
bioRxiv - Microbiology 2020Quote: ... 10×105 cells/mL was allotted into individual wells of a 6-well plate (BD Biosciences) and incubated in a humidified atmosphere that contained 5% CO2 for 24 h at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... or a complete LB+agar pre-mix (“LB Agar 3”; BD Difco, catalog # DF0445-07-6) and found that LB Agar 3 requires about ≈10x less of the additive lauryl LSB (≈0.1% ...
-
bioRxiv - Cancer Biology 2021Quote: ... or propidium iodide (PI) solution (eBioscience) and analyzed with a 6-Laser Fortessa cytometer (BD Biosciences). For accurate cell number quantification ...
-
bioRxiv - Cancer Biology 2020Quote: ... The following antibodies were used (volume per 1×10^6 cells): CD34 APC-Cy7 (2μl, BD), CD117 PE (2μl ...
-
bioRxiv - Immunology 2021Quote: ... The following kits were used to detect indicated cytokines: Mouse IL-6 Flex Set (BD, 558301), Mouse TNF Flex Set (BD ...
-
bioRxiv - Immunology 2021Quote: ... we used the following 14 antibodies::fluorophore conjugates and clones: HLA-DR::BUV395 (BD; G46-6), CD14::BUV737 (BD ...
-
bioRxiv - Microbiology 2021Quote: ... Serial dilutions were performed and plated on 1/6 Tryptic Soy medium (BD, Maryland, 21152. USA), solidified with 1.5% agar ...
-
bioRxiv - Immunology 2022Quote: ... the cells were stimulated with their cognate peptide gp33 (10−6 M) and Golgistop (BD, 554724) for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... and incubated overnight with a cocktail of intracellular antibodies – IL-6 (BD Biosciences, MQ2-6A3, FITC), TNFα (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... Bcl-6-PE (cat # 569522) and phosphor-STAT5-PE (pY694) (cat # 612567) were procured from BD Biosciences.
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μl of this suspension (1×10e5) was transferred to a 5 ml culture tube and 5 μl of FITC Annexin V (BD Biosciences) added ...
-
bioRxiv - Developmental Biology 2024Quote: All cell culture of all species was maintained at 37°C with 5% CO2 and 5% O2 on Matrigel (1:100, BD Corning) coated plates unless otherwise specified ...
-
bioRxiv - Cell Biology 2019Quote: NHEM cells were trypsinized and seeded at density of 1X105cells/well in 6-well plate (BD Bioscience) and incubated overnight with antibiotic containing M254 (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... Concentrations of IL-6 and IL-10 were interpolated using FCAP Array software (v. 3.1, BD Biosciences) from standard curves ...
-
bioRxiv - Cell Biology 2020Quote: ... 1×106 293FT cells were plated into 6-well plate coated with collagen I (BD Bioscience, #354236), transfection was performed with retroviral constructs together with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... The ELISA was then performed as per the manufacturer’s instructions (BD Bioscience IL-6 ELISA Cat. #555220), and concentrations determined by interpolating absorbance values of samples using a standard curve.
-
bioRxiv - Developmental Biology 2021Quote: ... non-adherent bone marrow cells were seeded in triplicate in 6-well collagen-coated plates (BD Biosciences) at a density of 1×105 cells/well ...
-
bioRxiv - Microbiology 2021Quote: ... P was analyzed (as molybdate reactive P) in the 6 extracts (referred to as H2O-P, BD-P ...
-
bioRxiv - Immunology 2020Quote: ... then stained with the antibodies described in Supplementary Table 6 and analysed on the LSRII (BD Bioscience). Data were analysed with the FlowJo v10.4.2 software (FlowJo LLC).
-
bioRxiv - Microbiology 2020Quote: ... and IFN-γ secreted by splenocytes of C57BL/6 mice were determined using ELISPOT kits (BD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Stained cells were analyzed using a BD LSRII Fortessa equipped with FACSDiva software (Version 6) (BD Pharmingen). Samples were acquired using Fortessa’s HTS plate reader option at an event rate below 20,000 events/s ...
-
bioRxiv - Microbiology 2023Quote: ... a final concentration of 10 μg/ml Brefeldin A and 6 μg/ml Golgi-Stop (BD Biosciences) were added ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Bioengineering 2019Quote: ... containing 5% (vol/vol) Nu-Serum I (BD Biosciences), 1% ITS+ Premix (BD Biosciences) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Microbiology 2019Quote: ... from Biolegend and CD4-Alexa Fluor 700 (RM4-5) from BD Biosciences ...
-
bioRxiv - Immunology 2019Quote: ... 5 μl of 7-AAD (BD Pharmingen, ref 559925) were added on cells 10 minutes before flow cytometry analysis ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...