Labshake search
Citations for Becton, Dickinson and Company :
401 - 450 of 6597 citations for 6 Diazo 5 6 dihydro 5 oxo 1 naphthalenesulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... or propidium iodide (PI) solution (eBioscience) and analyzed with a 6-Laser Fortessa cytometer (BD Biosciences). For accurate cell number quantification ...
-
bioRxiv - Immunology 2021Quote: ... The following kits were used to detect indicated cytokines: Mouse IL-6 Flex Set (BD, 558301), Mouse TNF Flex Set (BD ...
-
bioRxiv - Immunology 2021Quote: ... we used the following 14 antibodies::fluorophore conjugates and clones: HLA-DR::BUV395 (BD; G46-6), CD14::BUV737 (BD ...
-
bioRxiv - Immunology 2022Quote: ... the cells were stimulated with their cognate peptide gp33 (10−6 M) and Golgistop (BD, 554724) for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... and incubated overnight with a cocktail of intracellular antibodies – IL-6 (BD Biosciences, MQ2-6A3, FITC), TNFα (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... Bcl-6-PE (cat # 569522) and phosphor-STAT5-PE (pY694) (cat # 612567) were procured from BD Biosciences.
-
bioRxiv - Microbiology 2020Quote: ... 1% BactoTM Casamino acids (BD Biosciences, UK) or in selective CA medium containing only 5% BactoTM casamino acids in 18 % SW (Salt water ...
-
bioRxiv - Bioengineering 2019Quote: ... anti-IL1B (5 µl per 1×106 cells in 100 µL, Cat. no. 340515, BD bioscience), anti-IL10 (5 µl per 1×106 cells in 100 µL ...
-
bioRxiv - Bioengineering 2019Quote: ... anti-IL10 (5 µl per 1×106 cells in 100 µL, Cat. no. 562400, BD bioscience), and anti-IL8 (5 µl per 1×106 cells in 100 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... for 5 to 7 minutes at 37 °C and replated on 1:120 Matrigel™ (BD) in phosphate-buffered saline (Thermo Fisher Scientific)–coated plates at a density of 60–70,000 cells/cm2 in expansion medium with 5 μ M Y27632 (Stemgent) ...
-
bioRxiv - Immunology 2022Quote: ... all samples were incubated with FcR block (5 μg ml−1 αCD16/CD32 (2.4G2; BD Biosciences)) in 50 μl flow buffer (PBS containing 1% FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... APC Rat anti mouse CD4 (Monoclonal; clone RM4-5; BD Biosciences; 1:300; Cat#553041, FACS). PE-Cy7 Rat anti-mouse CD8 (Monoclonal ...
-
bioRxiv - Microbiology 2023Quote: ... We used Lennox lysogeny broth (5 g L−1 NaCl, BD Life Sciences, further abbreviated LB) media for overnight cultures and in the experiment and supplemented the overnight cultures with 300 µg/ml Trimethoprim (Trp ...
-
bioRxiv - Neuroscience 2021Quote: ... Stimulated cells were stained with fluorochrome-conjugated anti-MCP-1 and anti-IL-6 Abs using the Cytofix/Cytoperm kit (BD Biosciences, San Jose, CA) to determine MCP-1 and IL-6 production ...
-
bioRxiv - Immunology 2019Quote: ... were injected subcutaneously along with engineered stromal cells (1:1 to 1:5 ratio HSPC/MS5) in 200 μl of ice-cold Matrigel® (BD Biosciences). Mice were sacrificed at day 12 of differentiation by cervical dislocation and Matrigel® plugs were collected ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies (Claudin-5, Abcam Ab131259, 1:1000; Collagen IV, Abcam Ab6586, 1:500; Hemoglobin, R&D Systems G-134-C, 1:300; P62, BD Biosciences 610833 ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 g l-1 casamino acids, 0.024 g l-1 pantothenic acid and 10% (v/v) OADC (Oleic acid, Albumin, Dextrose and Catalase) (BD, 212351)] ...
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Cancer Biology 2021Quote: ... γδ T cells were washed twice in cold FACS buffer (PBS, 5 mM EDTA, 1% bovine serum antigen) and stained with 1:20 anti-CD3-PerCP-Cy5.5 (BD Biosciences), 1:20 anti-TCRγδ-PE (BD Bioscience) ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then blocked in PBS + 5% BSA for 1 hour before addition of primary antibodies (anti-LC3A/B, CST #4108, 1:100; anti-LAMP1, BD #555798, 1:100) diluted in blocking buffer overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs were stimulated with the RBD peptide pool (5 μg.ml−1 final concentration) and brefeldin A (1 μg.ml−1 ; BD Pharmingen, San Diego, CA, USA) at 37 °C overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... an affinity-purified mouse mAb that recognizes an epitope in the C-terminal NAD binding and catalytic domain of human PARP1 (clone 7D3-6, BD Biosciences #556493; 1:500 dilution); anti-cc-PARP1 ...
-
bioRxiv - Microbiology 2023Quote: ... Bladder cells were concentrated to 4 x 105 /mL and 1 mL was dispensed into a 6-well sterile culture dish (BD Falcon; 35 x 18 mm2) and incubated at 37°C with 5% CO2 for 24 h ...
-
bioRxiv - Cell Biology 2019Quote: NHEM cells were trypsinized and seeded at density of 1X105cells/well in 6-well plate (BD Bioscience) and incubated overnight with antibiotic containing M254 (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... Concentrations of IL-6 and IL-10 were interpolated using FCAP Array software (v. 3.1, BD Biosciences) from standard curves ...
-
bioRxiv - Cancer Biology 2022Quote: ... The ELISA was then performed as per the manufacturer’s instructions (BD Bioscience IL-6 ELISA Cat. #555220), and concentrations determined by interpolating absorbance values of samples using a standard curve.
-
bioRxiv - Developmental Biology 2021Quote: ... non-adherent bone marrow cells were seeded in triplicate in 6-well collagen-coated plates (BD Biosciences) at a density of 1×105 cells/well ...
-
bioRxiv - Microbiology 2021Quote: ... P was analyzed (as molybdate reactive P) in the 6 extracts (referred to as H2O-P, BD-P ...
-
bioRxiv - Immunology 2020Quote: ... then stained with the antibodies described in Supplementary Table 6 and analysed on the LSRII (BD Bioscience). Data were analysed with the FlowJo v10.4.2 software (FlowJo LLC).
-
bioRxiv - Microbiology 2020Quote: ... and IFN-γ secreted by splenocytes of C57BL/6 mice were determined using ELISPOT kits (BD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Stained cells were analyzed using a BD LSRII Fortessa equipped with FACSDiva software (Version 6) (BD Pharmingen). Samples were acquired using Fortessa’s HTS plate reader option at an event rate below 20,000 events/s ...
-
bioRxiv - Microbiology 2023Quote: ... a final concentration of 10 μg/ml Brefeldin A and 6 μg/ml Golgi-Stop (BD Biosciences) were added ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies against IdU and CldU were diluted in 5% BSA at 1:100 (BD Biosciences 347580) and 1:250 (abcam ab6326 ...
-
bioRxiv - Systems Biology 2022Quote: ... ~1 × 10^5 events were collected for each sample with a BD LSRFortessa system (BD Biosciences, USA) and FlowJo software 7.6.1 was used for data process.
-
bioRxiv - Bioengineering 2019Quote: ... and anti-IL8 (5 µl per 1×106 cells in 100 µL, Cat. no. 563310, BD bioscience). Cells were then washed ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 5 times with ice-cold PBS and then resuspended in 1× binding buffer (BD Biosciences, USA) at a concentration of 1 × 106 cells/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.1% Tween 20] and 5% milk for 1 hour and incubated overnight with GTF2I (BD Biosciences) and GAPDH (Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were subcutaneously injected using a 1 mL 25G x 5/8 syringe (BD, cat. no. 309626). Mice were visually monitored for tumor formation routinely following injection ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...