Labshake search
Citations for Becton, Dickinson and Company :
251 - 300 of 7024 citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was done with 5% skim milk (BD) in TBST (TBS+0.1% Tween-20) ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-APC (BD Bioscience, X54-5/7.1), Anti-F4/80-BV421 (Biolegend ...
-
bioRxiv - Systems Biology 2023Quote: ... anti–IFN-γ (5 µg/mL; BD Biosciences), and anti–IL-12 (5 µg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μl of anti-CD45-APC (BD Biosciences), and 5 μl of anti-CD326 (EPCAM)-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Systems Biology 2023Quote: ... anti–IL-4 (5 µg/mL; BD Biosciences); Th2 cells ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-AF647 (BD Pharmigen, X54-5/7.1), Anti-Siglec-F-PE (BD Pharmigen ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µg/ml anti-ITGB1 (BD Bioscience) in BMMC culture media at 37°C and 5% CO2 for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), and anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Microbiology 2020Quote: ... 1% BactoTM Casamino acids (BD Biosciences, UK) or in selective CA medium containing only 5% BactoTM casamino acids in 18 % SW (Salt water ...
-
bioRxiv - Immunology 2022Quote: About 8 ml of blood was collected in acid citrate dextrose (ACD) tubes (Cat. Number 364606, BD Biosciences) for platelet isolation ...
-
bioRxiv - Bioengineering 2019Quote: ... anti-IL1B (5 µl per 1×106 cells in 100 µL, Cat. no. 340515, BD bioscience), anti-IL10 (5 µl per 1×106 cells in 100 µL ...
-
bioRxiv - Bioengineering 2019Quote: ... anti-IL10 (5 µl per 1×106 cells in 100 µL, Cat. no. 562400, BD bioscience), and anti-IL8 (5 µl per 1×106 cells in 100 µL ...
-
bioRxiv - Immunology 2022Quote: ... all samples were incubated with FcR block (5 μg ml−1 αCD16/CD32 (2.4G2; BD Biosciences)) in 50 μl flow buffer (PBS containing 1% FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... APC Rat anti mouse CD4 (Monoclonal; clone RM4-5; BD Biosciences; 1:300; Cat#553041, FACS). PE-Cy7 Rat anti-mouse CD8 (Monoclonal ...
-
bioRxiv - Microbiology 2023Quote: ... We used Lennox lysogeny broth (5 g L−1 NaCl, BD Life Sciences, further abbreviated LB) media for overnight cultures and in the experiment and supplemented the overnight cultures with 300 µg/ml Trimethoprim (Trp ...
-
bioRxiv - Neuroscience 2022Quote: Transfected SY5Y cells were plated on the porous filter of the upper chamber of transwell culture dishes (8 μm pore size; BD Falcon, NJ, 5 x 104 cells/ml). The cells were then incubated for 60 hours in a 37°C ...
-
bioRxiv - Immunology 2019Quote: ... were injected subcutaneously along with engineered stromal cells (1:1 to 1:5 ratio HSPC/MS5) in 200 μl of ice-cold Matrigel® (BD Biosciences). Mice were sacrificed at day 12 of differentiation by cervical dislocation and Matrigel® plugs were collected ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies (Claudin-5, Abcam Ab131259, 1:1000; Collagen IV, Abcam Ab6586, 1:500; Hemoglobin, R&D Systems G-134-C, 1:300; P62, BD Biosciences 610833 ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 g l-1 casamino acids, 0.024 g l-1 pantothenic acid and 10% (v/v) OADC (Oleic acid, Albumin, Dextrose and Catalase) (BD, 212351)] ...
-
bioRxiv - Biochemistry 2023Quote: Cells were grown in synthetic complete medium at 25°C to mid-log phase after 7-8 doublings and harvested for direct fluorescent measurement of RFP and YFP channels by an LSR Fortessa (BD biosciences) flow cytometer ...
-
bioRxiv - Immunology 2022Quote: ... rat anti-mouse GL-7-FITC (1:1000, BD Pharmingen), rat anti-mouse CD38-PE-Cy7 (1:400 ...
-
bioRxiv - Immunology 2024Quote: ... TCF-1/7-BB700 (BD, cat. #353988, clone S33-96C) and a dead cell marker (LIVE/DEAD Fixable Near-IR ...
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Cancer Biology 2021Quote: ... γδ T cells were washed twice in cold FACS buffer (PBS, 5 mM EDTA, 1% bovine serum antigen) and stained with 1:20 anti-CD3-PerCP-Cy5.5 (BD Biosciences), 1:20 anti-TCRγδ-PE (BD Bioscience) ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Cancer Biology 2024Quote: NF1-proficient and NF1-deficient engineered clones were injected into the flanks of 6- to 7-week-old athymic nude mice (1.0×106 cells) in 50% Matrigel (BD Biosciences). Mice were monitored for tumor formation for 6 months post injection or until a tumor volume of 2000mm3 was reached.
-
bioRxiv - Immunology 2022Quote: ... 7-AAD (7-aminoactinomycin D, cat# 559925, BD Pharmingen) was added at 1/250th v/v ...
-
bioRxiv - Immunology 2019Quote: ... 7-AAD (7-amino-actinomycin D) 0.5mg/L (BDbiosciences)or DAPI 1mg/L were used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... Viable 7-aminoactinomycin-D-excluding (7-AAD; BD Pharmingen) CD3-APC+ (eBioscience ...
-
bioRxiv - Immunology 2022Quote: ... and 7-amino-actinomycin D (7-AAD; BD Biosciences) to detect dead cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then blocked in PBS + 5% BSA for 1 hour before addition of primary antibodies (anti-LC3A/B, CST #4108, 1:100; anti-LAMP1, BD #555798, 1:100) diluted in blocking buffer overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs were stimulated with the RBD peptide pool (5 μg.ml−1 final concentration) and brefeldin A (1 μg.ml−1 ; BD Pharmingen, San Diego, CA, USA) at 37 °C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies against IdU and CldU were diluted in 5% BSA at 1:100 (BD Biosciences 347580) and 1:250 (abcam ab6326 ...
-
bioRxiv - Systems Biology 2022Quote: ... ~1 × 10^5 events were collected for each sample with a BD LSRFortessa system (BD Biosciences, USA) and FlowJo software 7.6.1 was used for data process.
-
bioRxiv - Bioengineering 2019Quote: ... and anti-IL8 (5 µl per 1×106 cells in 100 µL, Cat. no. 563310, BD bioscience). Cells were then washed ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 5 times with ice-cold PBS and then resuspended in 1× binding buffer (BD Biosciences, USA) at a concentration of 1 × 106 cells/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.1% Tween 20] and 5% milk for 1 hour and incubated overnight with GTF2I (BD Biosciences) and GAPDH (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... BV421-IL-8 (BD, G265-8).
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...