Labshake search
Citations for Becton, Dickinson and Company :
4501 - 4550 of 7984 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v galactose (BD Biosciences 216310)) at an OD600 of 0.3 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v Bacto-peptone (BD Biosciences), and 2% w/v raffinose (Becton Dickinson 217410)) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v Bacto-peptone (BD Biosciences), 2% w/v galactose (BD Biosciences 216310) ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV421 (BD, 563259), 1 μl of SA-BUV615 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV480 (BD, 564876), 2 μl of SA-BV421 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV605 (BD, 563260), 2 μl of SA-BV480 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BUV395 (BD, 564176), 0.4 μl of SA-BYG670 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV650 (BD, 563855), 2 μl of SA-BV605 (BD ...
-
bioRxiv - Immunology 2021Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (Clone GK1.5 ...
-
bioRxiv - Genomics 2021Quote: ... Panel 2: CD206 (19.2, PE, 555954 BD), CD36 (SMΦ ...
-
bioRxiv - Immunology 2021Quote: ... Surface markers include: CD3 (SP34-2, BD), CD4 (L200 ...
-
bioRxiv - Immunology 2021Quote: ... CD3e (clone SP34-2, BD Biosciences, 557917), CD4 (clone L200 ...
-
bioRxiv - Cell Biology 2021Quote: ... coated with ICAM-2 (BD Biosciences Pharmingen) for the first selection ...
-
bioRxiv - Microbiology 2020Quote: ... 2 g/L Casamino Acids (BD Biosciences), and 5 g/L glycerol (Scharlab)) ...
-
bioRxiv - Immunology 2024Quote: ... IgD-FITC (BD Biosciences, clone IA6-2). A baiting approach was used to isolate the spike-specific B cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacto-agar (2% w/v; BD, 214010) and dextrose (2% w/v ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of CD3 antibody (BD Pharmingen), 5 μl of CD4 antibody (BD Pharmingen ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Flotillin-2 (610383, BD Biosciences), mouse anti-GAPDH (5G4cc ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% Bacto peptone (Becton, Dickinson and Company), and 2% D-glucose.
-
bioRxiv - Immunology 2023Quote: ... IgD-FITC (BD Biosciences, clone IA6-2) to allow for identification of memory B cells ...
-
bioRxiv - Immunology 2023Quote: ... and CD138 (Clone 281-2, BD Biosciences) for 20 min on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... ICAM-2+ and CD31+ endothelial cells (BD FACS Aria™ III Cell Sorter ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD95 (clone Jo-2; BD Biosciences), anti-CD138 (clone 281-2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 ml of Stain Buffer (BD Biosciences) was added ...
-
bioRxiv - Immunology 2024Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (clone GK1.5 ...
-
bioRxiv - Microbiology 2024Quote: ... 2% CHG in 70% Isopropanol (ChloraPrep; BD) was serially diluted with 1X PBS ...
-
bioRxiv - Immunology 2024Quote: ... CD80-BV650 (clone M18/2, BD Bioscience), MHCII-BUV661(clone M5/114 ...
-
bioRxiv - Immunology 2024Quote: ... with 2 μM Golgi Plug (BD Biosciences) added for the last 3 h of stimulation ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-flotillin-2 (BD Biosciences 610384), rabbit anti-CD9 (CST D801A) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% (w/v) Bacto TM peptone (BD), pH 5.5
-
bioRxiv - Cancer Biology 2024Quote: ... Skim Milk 2 g (BD Cat #232100), Saline solution 0.9% (Sodium chloride ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Bioengineering 2023Quote: ... was used as cloning strain and grown at 37°C in 2*Peptone Yeast Extract mdia (2*PY, 1.6% tryptone peptone (BD), 1% Bacto™ yeast extract (BD ...
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... Overnight cultures were diluted at OD600=0.2 in 6 well polystyrene plates (TPP) in 2 mL of minimal medium (SD: 2% glucose, 0.67% yeast nitrogen base without amino acids (BD), pH 5.4 ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Microbiology 2022Quote: ... CD64 Brilliant Violet 786 (X54-5/7.1, BD Bioscience), MHC-II I-A/I-E Pacific Blue (M5/114.15.2) ...