Labshake search
Citations for Becton, Dickinson and Company :
401 - 450 of 908 citations for Rat ZFP90 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies used were PE rat anti-mouse CD31 (1:200; BD Biosciences), PE rat anti-mouse TER-119 (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-mouse CD44-BV605 (clone IM7, 1:300, BD cat#563058). Cells were then fixed and permeabilized using the eBioscience fixation/permeabilization kit (ThermoFischer ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-mouse CD44-FITC (clone IM7, 1:300, BD cat#561859). Cells were then fixed and permeabilized using the BD Cytofix/Cytoperm™ kit according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by overnight incubation with rat anti-CD31 (1:100, BD Bioscience) and rabbit anti-Desmin (1:100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... as a marker for ER [23] and rat anti-mouse CD9 (BD-Pharmingen ...
-
bioRxiv - Developmental Biology 2022Quote: ... CD31 was visualized by using biotinylated CD31 rat anti-mouse (BD Biosciences) and Cy5-conjugated Streptavidin (Jackson Immunoresearch ...
-
bioRxiv - Neuroscience 2021Quote: ... and rat anti-CD45 (#550539, Clone 30-F111, 1:100, BD Biosciences). Sequential imaging was performed on an Olympus FluoView confocal laser-scanning microscope (FV1200 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were grown on rat-tail collagen I coated flasks (BD Biosciences) in EBM-2 medium supplemented with EGM-2MV SingleQuots (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... CD31 (APC Rat Anti-Mouse CD31, 551262, BD Biosciences, clone MEC 13.3), Notch3 (anti-Notch3 antibody ...
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-mouse monoclonal VEGFR2/FLK1 (BD Pharmingen, Avas 12α1, Cat. #550549). Secondary antibodies used were goat anti-mouse Alexa Fluor 594 and 488 ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies included rat anti-mouse PE-Cy7-conjugated CD45R/B220+ (BD Biosciences), rat anti-mouse FITC-conjugated GL7 (BD Biosciences) ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-mouse CD31 (Cat# 553370, BD Pharmingen, San Jose, CA, USA), goat anti-mouse ITGA9 (Cat # AF3827 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-Col4 and rat anti-PECAM (1:100; BD Bioscience 557355). Confocal images were obtained using a Zeiss 780 Laser Scanning Microscope with associated Zeiss Zen software.
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-mouse ITGA5 (Cat #553319, BD Pharmingen, San Jose, CA, USA), goat anti-mouse GATA2 (Cat #AF2046 ...
-
bioRxiv - Immunology 2020Quote: ... rat anti-mouse Ly-6G (Gr-1) (BD Biosciences, BD550291, 1:50), rat anti-mouse CD68 (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-mouse CD19-BV785 (clone 1D3, 1:200, BD, cat#563333), rat anti-mouse CD38-APCy7 (clone 90 ...
-
bioRxiv - Cell Biology 2019Quote: ... conformational epitope β1-integrin (1:50; rat; BD Pharmingen #550531, clone 9EG7), paxillin (1:100 ...
-
bioRxiv - Developmental Biology 2020Quote: ... rat anti-mouse CD31 (Cat# 553370, BD Pharmingen, San Jose, CA, USA), rat anti-mouse VE-Cadherin (Cat# 550548 ...
-
bioRxiv - Cell Biology 2019Quote: ... coverslips were coated with rat tail collagen solution (BD Biosciences, Bedford, USA) and cells were plated in low density networks (1K per 12-well ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-Plasmalemma vesicle associated protein (PLVAP, 1:125, 553849, BD Biosciences), rabbit anti-Prospero Homeobox 1 (PROX1 ...
-
bioRxiv - Cell Biology 2021Quote: The following primary antibodies were used: CD34 (Rat, 1:100, BD Bioscience), CD45 (Rat ...
-
bioRxiv - Immunology 2021Quote: ... and rat anti-mouse panendothelial cell antigen (clone, MECA-32, BD Pharmingen) at 4°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... and blocked by purified rat anti-mouse CD16/CD32 purchased from BD Bioscience and eBioscience ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... rat anti-mouse Ly-6G (Gr-1) (BD Biosciences, BD550291, 1:50), rat anti-mouse CD68 (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... rat anti-CD44 (1:500, cat #550538, BD Pharmingen, San Jose, CA), rabbit anti-cleaved caspase3 (1:1000 ...
-
bioRxiv - Genetics 2022Quote: ... Brilliant Violet 421 Rat Anti-Mouse CD196 (CCR6; Clone 140706; BD Biosciences); PE Rat anti-mouse IL-17A (clone TC11-18H10.1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and BV421 Rat Anti-Mouse CD106 (VCAM-1) Clone 429 (BD Biosciences). For in vivo imaging ...
-
bioRxiv - Immunology 2023Quote: ... biotinylated rat anti-mouse IgG2a antibody (1:300; BD Biosciences, Cat. 550332), or horseradish peroxidase (HRP)-conjugated rabbit anti-guinea pig IgG (H+L ...
-
bioRxiv - Cancer Biology 2023Quote: ... The following antibodies were used: Rat anti-mouse B220 (BD 550286, RRID:AB_393581), Rabbit anti-mouse CD4 (ab183685 ...
-
bioRxiv - Immunology 2023Quote: ... CD4 (V450 rat anti-mouse CD4; 1:200; BD Biosciences, Cat. 560468) and CD8 (APC-H7 rat anti-mouse CD8a ...
-
bioRxiv - Microbiology 2023Quote: ... Coverslips were stained with rat anti-mouse LAMP1 (1:1,000; BD Biosciences) along with guinea pig anti-C ...
-
bioRxiv - Neuroscience 2023Quote: The following antibodies were used: BV750 Rat Anti-Mouse CD45 (BD, 746947); BUV661 Rat Anti-Mouse Ly-6G (BD ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat anti-mouse CD16/32 Fc Block (BD Biosciences, Catalog no. 553142), and surface markers CD4 anti-mouse BB700 (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... CD25 (BV510 Rat Anti-Mouse CD25; clone PC61; BD Biosciences; Cat # 563037), CD29 (APC-Efluor 780 Anti-mouse CD29 antibody ...
-
bioRxiv - Microbiology 2023Quote: ... and PerCP-Cy5.5-conjugated rat anti-CD4 (clone RM4-5; BD Biosciences), followed by intracellular staining with Alexa Fluor 647– conjugated mouse anti-mouse T-bet (clone 4B10 ...
-
bioRxiv - Immunology 2023Quote: ... and APC rat anti-mouse CD138 (#558626, clone 281-2, BD Biosciences). Cells were acquired using the LSR II instrument (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... Two hybrid plasmid pKBB486 (Crm1-BD) was constructed by PCR amplification of full-length CRM1 using oligonucleotides 5’- TGAAGATACCCCACCAAACCCAAAAAAAGAGATCGAATTCCAGCTGACCACCATGGAAGGAATTTTGGA TTTTTCTAACG-3’ and 5’- TTTTCAGTATCTACGATTCATAGATCTCTGCAGGTCGACGGATCCCCGGGAATTGCCATGTAATCATCAA GTTCGGAAGG-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primary antibodies used: rat anti-mouse CD31 (cat. #553370, BD Biosciences, 1:100), rabbit anti-ERG (cat ...
-
bioRxiv - Cell Biology 2022Quote: ... on flasks coated with collagen I (rat tail; BD Bioscience, New Jersey, US). Keratinocytes immortalize spontaneously after 10-15 passages ...
-
bioRxiv - Immunology 2021Quote: ... cell suspensions were Fc-receptor blocked with polyclonal rat IgG-UNLB (2,4G2; BD) and stained according to standard protocols ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD45 APC-Cy7 (Rat anti-mouse, BD Pharmingen, Catalog No. 557659, 1/300), CD31 APC (Rat anti-mouse ...
-
bioRxiv - Systems Biology 2019Quote: ... Antibodies used were Alexa Fluor 647 rat anti-mouse CD73 (BD, cat: 561543) and Alexa Fluor 555 mouse anti-Ecadherin (BD ...
-
bioRxiv - Physiology 2020Quote: ... Neutrophils were identified using rat anti-Ly6G antibodies (BD Pharmingen Inc, Cat# 551459). T lymphocytes were identified using goat anti-CD3 antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2019Quote: ... stained with anti-rat IgM (Clone G53-238, BD Biosciences, San Jose, CA) conjugated to PE Cy7 ...
-
bioRxiv - Neuroscience 2021Quote: ... Then combinations of the following antibodies: rat anti-PDGFRα (1:200, BD Biosciences), rat anti-RFP (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-active integrin beta1/CD29 9EG7 (BD Pharmingen, 553715, IF 1:100), rabbit anti-integrin beta1 c-term (LSBio ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-mouse CD4-AF700 (clone RM4-5, 1:200, BD cat#557956), rat anti-mouse CD8-APCy7 (clone 53-6.7 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Compensations were attained using Anti-Rat and anti-hamster compensation beads (BD Biosciences). For fixable live/dead staining ...
-
bioRxiv - Cell Biology 2020Quote: ... or rat antibodies against β1-integrin (9EG7 clone, BD Transduction, #553715, 1:100) or rabbit antibodies against pPax-Y118 (Cell Signaling ...
-
bioRxiv - Cell Biology 2022Quote: ... dishes were collagen I-coated by diluting rat tail collagen I (BD Biosciences) to 50 μg/ml in sterile 0.02N acetic acid and applying at 5 μg/cm2 for one hour at room temperature in a tissue culture hood ...