Labshake search
Citations for Becton, Dickinson and Company :
351 - 400 of 2278 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 2% (w/v) Bacto TM peptone (BD), pH 5.5
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-flotillin-2 (BD Biosciences 610384), rabbit anti-CD9 (CST D801A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Skim Milk 2 g (BD Cat #232100), Saline solution 0.9% (Sodium chloride ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Microbiology 2022Quote: ... 5 times with a 1 mL syringe (BD, Spain). This was the control sample.
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Immunology 2020Quote: ... CD38-FITC 1:5 (clone HIT2, BD Biosciences, 560982), and SARS-CoV-S1-CF647 at 1 µg/ml for patients CV07 ...
-
bioRxiv - Immunology 2022Quote: ... anti-CD4-BV605 (BD Biosciences 563151: Clone: RM4-5), and anti-CD8a Super Bright 702 (Invitrogen 67-0081-82 ...
-
bioRxiv - Molecular Biology 2023Quote: ... resulting in five healthy postlarvae (1 to 5-BD) and five surviving diseased postlarvae (6 to 10-BD) ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD2 PE (clone RM2-5, BD Pharmingen, RRID: AB_2073810), CD5 PE (clone 53-7.3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:5 BD Horizon Brilliant Stain buffer (BD Biosciences), and 1:25 FcR blocking reagent (Miltenyi) ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-CD4 (clone RM4-5, BD Bioscience, cat # BDB553043), anti-CD8 (clone 4SM15 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5 g/l Bacto yeast extract (BD Biosciences, UK), 10 g/l NaCl (Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... After blocking with 5% nonfat milk (BD Biosciences, USA) for 2h ...
-
bioRxiv - Immunology 2024Quote: ... CD4+ (BV785 or BV605, GK1.5 or RM4-5, BD) Thy1.1+ ...
-
bioRxiv - Immunology 2024Quote: ... monensin (5 mg/ml; Golgi Stop, BD Biosciences, USA) and Brefeldin A (5 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... or 5-laser LSRFortessa X-20 (all BD Biosciences), a 3-laser Attune NxT (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking with FcBlock antibody (5 mg/ml, BD) for 10 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked in 5% skim milk (BD Biosciences) in TBS with 0.1% Tween-20 and incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 g/l Bacto yeast extract (BD Biosciences, UK), 10 g/l NaCl (ThermoFisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... and anti–IL-12 (5 µg/mL; BD Biosciences); Treg ...
-
bioRxiv - Microbiology 2022Quote: ... CD64 Brilliant Violet 786 (X54-5/7.1, BD Bioscience), MHC-II I-A/I-E Pacific Blue (M5/114.15.2) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was blocked in 5% skimmed milk (BD) and probed with rabbit polyclonal antibody against Gαq ...
-
bioRxiv - Genomics 2022Quote: ... 5 g Bacto™ peptone (BD, Cat. No.: 9030688), 1 g Bacto™ yeast extract (BD ...
-
bioRxiv - Immunology 2022Quote: ... and CD4–PerCP-Cy5.5 (clone R4-5; BD Biosciences). For intercellular staining ...
-
bioRxiv - Microbiology 2022Quote: ... and 5% horse blood (BD, Franklin Lakes, New Jersey). Antibiotic susceptibility was determined using the bioMérieux Etest® platform (bioMérieux ...
-
bioRxiv - Immunology 2022Quote: ... anti-CD4-BV605 (BD Biosciences 563151: Clone: RM4-5), and anti-CD8a Super Bright 702 (Invitrogen 67-0081-82 ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked in 5% skim milk (BD), incubated 1 hour with primary mouse monoclonal antibody anti-HA tag (G036 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each membrane was blocked with 5% skim milk (BD) in TBST buffer (25 mM Tris ...
-
bioRxiv - Microbiology 2023Quote: ... Bacto Yeast Extract (5 g/L; BD, Cat. # 212750), Glucose (2 g/L ...
-
bioRxiv - Immunology 2023Quote: ... 5% CO2 in the presence of GolgiPlug (BD Bioscience) before extracellular staining and then fixed with 2% paraformaldehyde overnight ...
-
bioRxiv - Immunology 2024Quote: ... CD64 BV786 (clone: X54-5/7.1, 741024; BD Biosciences), I-A/I-E PE-Cy7 (clone ...
-
bioRxiv - Microbiology 2024Quote: ... plates were blocked with 5% skim milk (BD Biosciences) diluted in PBS containing 0.05% Tween-20 (PBST ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4 (PE-CF594, clone RM4-5, BD 562314), anti-CD25 (APC ...