Labshake search
Citations for Becton, Dickinson and Company :
351 - 400 of 1653 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Cleaved caspase-3 (Essen Bioscience, 4704) and CD45 (BD Pharmingen™, 553076) staining was performed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then stained with anti-cleaved caspase 3-PE (BD #550821) and anti-GATA1 (Abcam ab181544 ...
-
bioRxiv - Microbiology 2021Quote: ... The 3-amino-9-ethycabazole (AEC) substrate kit was purchased from BD Pharmingen.
-
bioRxiv - Immunology 2020Quote: ... Cells were exposed to anti-CD40 (1ug/ml, BD Clone HM40-3) and rIL-4 (10 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... Flow cytometry cell sorting was performed on an ARIA 3 (BD Biosciences) apparatus on single-cell suspensions from spleens or Peyer’s patches ...
-
bioRxiv - Cancer Biology 2022Quote: ... human PBMCs (3×105 cells/condition) were incubated with CD8 (BD, 562428), CD25 (BD ...
-
bioRxiv - Immunology 2022Quote: ... perflava was cultured on Gonococcal medium base (GCB, BD #DF0289-17-3) plus Kellogg’s supplements [63] at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... GATA-3 (TWAJ, eF660, eBioscience, or L50-829, PE-Cy7, BD Biosciences), T-bet (4B10 ...
-
bioRxiv - Microbiology 2024Quote: ... single colonies were inoculated into 3 ml Tryptic Soy Broth (TSB, BD) with 10 µg/ml chloramphenicol (Cm10 ...
-
bioRxiv - Cell Biology 2024Quote: ... then sort-matched for GFP using a FACSMelody 3-laser sorter (BD).
-
bioRxiv - Immunology 2024Quote: ... was prepared and loaded into a 3 mL syringe (BD Biosciences, #309657). Primer-conjugated agarose was completely melted at 95°C for over 2 hours and subsequently loaded into a 3 mL syringe ...
-
bioRxiv - Genetics 2022Quote: ... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were stained with an activated caspase-3 antibody (BD Biosciences, anti:Rabbit) to mark apoptotic cells ...
-
bioRxiv - Immunology 2023Quote: ... anti-Active Caspase 3 BV650 (1:200, clone C92-605, BD Biosciences); anti-BCL-xL PE (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... Data analysis was performed using FCAP Array software v.3 (BD Biosciences).
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Biophysics 2024Quote: ... sealed at the other end by a 0.6x30mm needle (BD, microlance 3) attached to a 3mL syringe (Braun ...
-
bioRxiv - Microbiology 2024Quote: ... Parasitaemia was scored using flow cytometry (FACS Aria 3, BD Biosciences, USA) on glutaraldehyde-fixed samples ...
-
bioRxiv - Immunology 2024Quote: ... stained with FITC-conjugated Ab specific for cleaved caspase-3 (BD Biosciences), rinsed ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Microbiology 2022Quote: ... 5 times with a 1 mL syringe (BD, Spain). This was the control sample.
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Immunology 2020Quote: ... CD38-FITC 1:5 (clone HIT2, BD Biosciences, 560982), and SARS-CoV-S1-CF647 at 1 µg/ml for patients CV07 ...
-
bioRxiv - Microbiology 2022Quote: ... CD64 Brilliant Violet 786 (X54-5/7.1, BD Bioscience), MHC-II I-A/I-E Pacific Blue (M5/114.15.2) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was blocked in 5% skimmed milk (BD) and probed with rabbit polyclonal antibody against Gαq ...
-
bioRxiv - Genomics 2022Quote: ... 5 g Bacto™ peptone (BD, Cat. No.: 9030688), 1 g Bacto™ yeast extract (BD ...
-
bioRxiv - Immunology 2022Quote: ... and CD4–PerCP-Cy5.5 (clone R4-5; BD Biosciences). For intercellular staining ...
-
bioRxiv - Microbiology 2022Quote: ... and 5% horse blood (BD, Franklin Lakes, New Jersey). Antibiotic susceptibility was determined using the bioMérieux Etest® platform (bioMérieux ...
-
bioRxiv - Immunology 2022Quote: ... anti-CD4-BV605 (BD Biosciences 563151: Clone: RM4-5), and anti-CD8a Super Bright 702 (Invitrogen 67-0081-82 ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked in 5% skim milk (BD), incubated 1 hour with primary mouse monoclonal antibody anti-HA tag (G036 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each membrane was blocked with 5% skim milk (BD) in TBST buffer (25 mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-CD4 (clone RM4-5, BD Bioscience, cat # BDB553043), anti-CD8 (clone 4SM15 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5 g/l Bacto yeast extract (BD Biosciences, UK), 10 g/l NaCl (Fisher Scientific ...