Labshake search
Citations for Becton, Dickinson and Company :
3901 - 3950 of 5447 citations for Mouse Serine threonine protein kinase PINK1 mitochondrial PINK1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... was performed using the Cytofix/Cytoperm kit (BD Biosciences) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and stained with a Phosflow staining kit (BD Biosciences) using the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer’s protocol (BD Cytofix/Cytoperm kit).
-
bioRxiv - Immunology 2022Quote: ... following the BrdU Flow Kit manufacturer’s instructions (BD Pharmingen). For Ki67 analysis ...
-
bioRxiv - Immunology 2022Quote: ... and treated with a Cytofix/Cytoperm kit (BD Biosciences) per manufacturer protocol.
-
bioRxiv - Immunology 2022Quote: A human Th1/Th2/Th17 Cytokine Kit (BD Biosciences) was used to measure the production of cytokines as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... fixed/permeabalized using the BD cytofix/cytoperm kit (BD), and stained with anti-IFNγ (XMG1.2 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The Cytokine Bead Array kit was procured from BD Biosciences ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... FITC-Annexin V apoptosis detection kit 1 (BD PharmingenTM) was used to evaluate compound-induced apoptosis ...
-
bioRxiv - Immunology 2023Quote: ... using Cytofix/Cytoperm Fixation/Permeabilization Solution kit (BD Biosciences) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Viability was analyzed with Kit 7AAD/Annexin (BD Pharmingen), according to the manufacturer’s instructions ...
-
IRF1 regulates self-renewal and stress-responsiveness to support hematopoietic stem cell maintenancebioRxiv - Cell Biology 2023Quote: BD Annexin V: FITC Detection kit I (BD Pharmingen) was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... intracellular staining was performed using Citofix/CytopermTM kit (BD) following manufacturer instructions and using the following antibodies ...
-
bioRxiv - Immunology 2023Quote: ... the BD Cytofix/Cytoperm kit (BD Biosciences Cat. 554714) and FOXP3 Transcription Factor Staining Buffer set (eBioscience Cat ...
-
bioRxiv - Immunology 2023Quote: ... CytoFix/CytoPerm and Perm/Wash Buffer kit (BD, 554714) was used for intracellular staining steps ...
-
bioRxiv - Immunology 2022Quote: ... fixed and permeabilized with Cytofix/Cytoperm kit (BD Biosciences) prior to acquisition using FACSymphony ...
-
bioRxiv - Immunology 2023Quote: ... by using Cytofix/CytoPerm Plus kit (555028; BD Pharmingen). Samples were analyzed using a Fortessa flow cytometer (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using the Fixation/Permeabilization Kit (BD Biosciences #554714), and stained intracellularly ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using a Cytofix/Cytoperm solution kit (BD Biosciences), and intracellularly stained with anti-TNF-Alexa 700 (alone MAB11) ...
-
bioRxiv - Immunology 2023Quote: ... FITC-anti-BrdU (BD, BrdU flow kit, Cat#559619), Zombie Aqua fixable viability kit (BioLegend ...
-
bioRxiv - Pathology 2023Quote: ... WBC were quantified using the Leucocount Kit (BD, 340523). Platelet unit pH was measured daily by adding 25 μL of the platelet unit to pH strips with a pH range of 5-9 (Fisher ...
-
bioRxiv - Immunology 2024Quote: ... or Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (BD Bioscences). Final flow cytometry gating strategy for SFCs and PBMCs shown in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed using BD Cytofix kit (BD #554655) following manufacturer’s instructions and acquired on analyzer within 3 days of fixation ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was generated using the cDNA kit from BD. Libraries were prepared using the whole transcriptome analysis (WTA ...
-
bioRxiv - Immunology 2024Quote: ... and processed using BD Rhapsody Cartridge Reagent Kit (BD) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies (anti-Cas9 7A9-3A3, Cell Signaling Technology #14697S, anti-γ-tubulin Sigma#T5326, anti-Human Retinoblastoma protein BD Pharmigen #554136 ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Immunology 2021Quote: ... FNA samples were stained in P2 for 30 minutes on ice with biotinylated and Alexa Fluor 647 conjugated recombinant soluble Spike proteins as well as PD-1 BB515 (EH12.1, BD Horizon). Cells were then washed twice with P2 and stained with IgG BV480 (goat polyclonal ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...