Labshake search
Citations for Becton, Dickinson and Company :
3551 - 3600 of 4199 citations for Recombinant Mouse LTBR Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: IL-17 concentration in serum was measured by cytometric bead array mouse IL-17A Enhanced Sensitivity Flex Set (BDBiosciences)24 or by electrochemiluminescence-based multi-array MSD V-Plex Mouse IL-17A Kit (MesoScale)88 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were stained in 100ul of staining buffer (PBS + 2 % FBS) containing PE Mouse SNAI2/Slug (BD Biosciences 564615), EZH2 eFluor 660 (Thermo Fisher 50-9867-82) ...
-
bioRxiv - Immunology 2023Quote: ... β2 integrin blockade was performed with Purified NA/LE Rat Anti-Mouse CD18 (clone GAME-46, BD Pharmingen, 555280) and the isotype control antibody Purified NA/LE Rat Ig1 ...
-
bioRxiv - Immunology 2022Quote: ... JPT) were added at 0.6 nmol/ml in the presence of anti-mouse CD28/49d (1 μg/mL, BD) and brefeldin A (5 μg/ml ...
-
bioRxiv - Bioengineering 2023Quote: The following fluorochrome conjugated anti-mouse antibodies were used and included CD3 APC-Cy7 (BD Bioscience, New Jersey, USA), CD70 APC (Biolegend ...
-
bioRxiv - Cancer Biology 2023Quote: ... a rat anti-mouse Ly-6G/Ly-6C (Gr1) (RB6-8C5) antibody conjugated to PE-Cy7 (BD Pharmingen; 552985), and an rat anti-mouse CD11b (M1/70 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse EpSCs were incubated with PE-labeled CD71 antibody and FITC-conjugated CD49f antibody (BD Biosciences, San Jose, USA). PE/FITC-conjugated IgG2a was used as an isotype control ...
-
bioRxiv - Cell Biology 2023Quote: ... Ultra-thin sections were incubated at room temperature for 1 h with the primary antibody (e.g., mouse anti-NONO [BD Biosciences-N88520] ...
-
bioRxiv - Cancer Biology 2023Quote: ... we utilized a rabbit monoclonal antibody from Cell Signaling (Cat. #3094) or a mouse monoclonal AURKB antibody (Cat. # A78720) from Transduction Laboratories (now BD Bioscience, San Jose, CA). Rabbit monoclonal antibody (Cat ...
-
bioRxiv - Neuroscience 2024Quote: ... the following primary antibodies were used: 1) CtBP2 to visualize synaptic ribbons (mouse anti-CtBP2 at 1:200, BD Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... Fc receptor blockade and viability staining were simultaneously performed using Rat anti-mouse FcψRIII/II (CD16/32; BD Biosciences) and ZombieNIR (BioLegend ...
-
bioRxiv - Cancer Biology 2023Quote: ... Raji and U2932 NTC and CD20 KO cells were incubated with anti-CD37 mouse Ab (M-B371 clone, BD) and anti-CD20 human Ab (obinutuzumab ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal antibody against human CD49e/Integrin α5 Chain (1:1000 for western blotting; BD Pharmingen; catalogue number 555614); mouse monoclonal antibody against human Integrin alpha-5 (1:100 for immunofluorescence ...
-
bioRxiv - Genomics 2024Quote: ... or with the appropriate class control antibodies: PE Mouse anti-IgG1 κ R-PE Clone MOPC-21 (BD Biosciences) and Alexa Fluor® 647 Mouse anti IgG1 κ Isotype Clone MOPC-21 (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... 145-2C11, Cat. No. 553058) and mouse anti-CD28 (Clone: 37.51, Cat. No. 553294) monoclonal antibodies were purchased from BD Pharmingen and were used to coat glass bottom chambers for imaging assays in murine T cells ...
-
bioRxiv - Immunology 2024Quote: ... Serum supernatant was collected and loaded onto BD Cytometric Bead Array Mouse Th1/Th2/Th17 CBA kit (BD Biosciences), as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... bone marrow cells were stained using BD Stemflow™ Mouse Hematopoietic Stem and Progenitor Cell Isolation Kit (BD, 560492) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: Anti-mouse antibodies used for flow cytometry included: rat anti-CD31 (MEC 13.3, BD Pharmingen, San Diego, CA, USA), rat anti-CD45-APC (30F11 ...
-
bioRxiv - Immunology 2024Quote: ... that was emulsified in CFA containing 200 μg/mouse Mycobacterium tuberculosis H37Ra (Becton, Dickinson and Company, Sparks, MD, USA). 80 ng of pertussis toxin (PTX ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies (anti-Cas9 7A9-3A3, Cell Signaling Technology #14697S, anti-γ-tubulin Sigma#T5326, anti-Human Retinoblastoma protein BD Pharmigen #554136 ...
-
bioRxiv - Cell Biology 2021Quote: ... conjugated anti-c-kit and Peridinin Chlorophyll Protein Complex (PerCP) or allophycocyanin (APC) conjugated anti-CD45 antibodies were purchased from BD Biosciences Pharmingen ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies used are as follows and were used according to manufacturer’s protocol: PE-Cy7 Mouse Anti-Human CD3 (Cat 563423; BD Pharmingen), PE Mouse Anti-Human CD4 (Cat555347 ...
-
bioRxiv - Microbiology 2021Quote: ... Serum concentrations of total IgE were quantified with BD OptEIA™ Mouse IgE ELISA Set (BD Biosciences, San Chose, Canada) with samples diluted 1:100 according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... co-culture supernatants were thawed at room temperature for 1 hr and cytokines stained with mouse Th1/Th2/Th17 cytokine kit (BD) according to the manufacturer’s protocol ...