Labshake search
Citations for Becton, Dickinson and Company :
2951 - 3000 of 5394 citations for Serum amyloid A 2 protein SAA2 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Antibody cocktail panel 1 included: anti-CD45 (BV605, clone 30-F11, BD 563053), anti-CD11b (APC-Cy7 Clone M1/70 BD 561039) ...
-
bioRxiv - Immunology 2024Quote: ... The following antibodies were used: anti-mouse CD31 (clone MEC 13.3; BD Biosciences), anti-mouse CD45 (clone 30-F11 ...
-
bioRxiv - Immunology 2024Quote: ... 100 μg of anti-IL-4Ra monoclonal antibody (clone mIL4R-M1, BD Biosciences), or IgG isotype control were intraperitoneal injected at different time points.
-
bioRxiv - Immunology 2024Quote: Cells were stained with the following antibodies for analysis: CD45 (565967, BD Biosciences), CD31 (102434 ...
-
bioRxiv - Genomics 2024Quote: ... adaptor-ligated DNA fragments were immunoprecipitated with an anti-BrdU antibody (BD, #555627) and anti-mouse secondary antibody (Sigma-Aldrich #M7023 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The following primary antibodies were used: P-cadherin (BD Bioscience, #610227; 1:1,000), ERK1/2 (CST ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated with Fc receptor-blocking anti-CD16/CD32 antibody (BD Pharmingen) in FACS buffer for 15 minutes at 4⁰C ...
-
bioRxiv - Immunology 2024Quote: ... blocked and incubated with the primary antibody of interest (anti-pSTAT5 AF647, BD Biosciences ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated with the following primary antibodies: anti-Ly6G (BD Bioscience, #551459), anti-Vascular cell adhesion molecule 1 (VCAM1 ...
-
bioRxiv - Immunology 2024Quote: ... The following antibodies were used: anti-mouse CD31 (clone MEC 13.3; BD Biosciences), anti-mouse CD45 (clone 30-F11 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell-surface staining was performed using the following antibodies: CD45-Pacific Blue (BD), CD3-BV510 (BD) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then incubated with anti-Ki67 PE antibody (51-36525X, BD Bioscience) or with isotype PE (51-35405X ...
-
bioRxiv - Neuroscience 2024Quote: ... membranes were incubated with primary antibodies against monomeric α-synuclein (BD Bioscience, #610787), multimeric α-synuclein (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... Anti-SMN mouse monoclonal antibody (BD Transd Lab, clone 8, #610646; 1:10,000), anti-GAPDH mouse monoclonal antibody (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were incubated in freshly made SMN-antibody solution (mouse-anti-SMN, BD Bioscience 610647 ...
-
bioRxiv - Genomics 2024Quote: ... cells were also labeled with an CD158b AbSeq antibody (BD, Cat. No. 559784). 98 μl of stain buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... The membranes were probed with antibodies directed to CXCR4 (1:1,000; BD Pharmingen) and GAPDH (1:10,000 ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stained with conjugated monoclonal antibodies directed at IFNγ (XMG1.2) from BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... FITC Mouse Anti-Human MRP1 antibody (BD Biosciences, clone QCRL-3, cat#557593). Then cells were washed with PBS and analyzed by flow cytometry ...
-
bioRxiv - Biochemistry 2024Quote: ... USA). The primary antibody against TIM44 (Cat. No. 612582) was purchased from BD Transduction Laboratories (California ...
-
bioRxiv - Cancer Biology 2024Quote: The following primary antibodies were used in these studies: BrdU (BD Pharmingen, B44), LC3B (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... The following fluorophore-conjugated antibodies were used: SOX2-V450 (BD 561610, 1:100), TUBB3-AF488 (BioLegend 801203 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse monoclonal anti-Lamin A/C antibody (1:100) (BD Transduction Laboratories, 612162), goat polyclonal anti-Sox2 (R&D ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100,000 EB dissociated cells were stained with the following antibodies (all BD Biosciences): CD34-PeCy7 (#560710) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Immunology 2021Quote: ... FNA samples were stained in P2 for 30 minutes on ice with biotinylated and Alexa Fluor 647 conjugated recombinant soluble Spike proteins as well as PD-1 BB515 (EH12.1, BD Horizon). Cells were then washed twice with P2 and stained with IgG BV480 (goat polyclonal ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... Red blood cells were removed by adding 2 ml of BD FACS Lysing Solution (BD Bioscience, Heidelberg, Germany) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM MgCl2) for another 20 min at room temperature before analysis by FACSAria II (BD Biosciences).
-
bioRxiv - Microbiology 2020Quote: ... Cells were then washed 2 x in FACS buffer and then incubated in Cytofix fixation buffer (BD Biosciences). Cells again washed in FACS buffer prior to performing flow cytometry using a BD Fortessa flow cytometer and data analysis was performed using FlowJo software (Tree Star).
-
bioRxiv - Microbiology 2021Quote: ... serial dilutions of each well were plated on 2:1 plate count agar (247930, BD, Franklin Lakes, NJ) to standard agar (214530 ...