Labshake search
Citations for Becton, Dickinson and Company :
251 - 300 of 1281 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... FITC-Annexin V apoptosis detection kit 1 (BD PharmingenTM) was used to evaluate compound-induced apoptosis ...
-
bioRxiv - Developmental Biology 2024Quote: ... labeled with Mouse Immune Single-Cell Multiplexing Kit (BD) and loaded on a microwell cartridge of the BD Rhapsody Express system (BD ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Cancer Biology 2021Quote: Cell cycle analysis was performed using the BrdU Flow Kit according to the manufacturer protocol (BD, FITC BrdU Flow Kit; Cat. No. 559619), with cells pulsed with BrdU for 1 hour at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: pEU-E01 cell-free wheat germ expression vector containing ampicillin resistance and cell-free wheat germ expression kit (Cat# CFS-CPLE-BD Proteoliposome BD Kit) were obtained from CellFree Sciences Co. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PE Annexin V Apoptosis Detection Kit II from BD Biosciences was used to detect apoptotic T cells according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2019Quote: ... HSPCs were stained using c-Kit-APC (2B8; BD Biosciences), Sca-1-Cy7PE (D7 ...
-
bioRxiv - Bioengineering 2019Quote: ... Monocytes were enriched by using monocytes enrichment kit (BD biosciences) according to the manufacture instructions ...
-
bioRxiv - Immunology 2019Quote: The Cytokine Bead Array Mouse Inflammation kit (BD Biosciences 552364) was used according to manufacturer’s instructions for simultaneous measurement of IL-6 ...
-
bioRxiv - Immunology 2020Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Cancer Biology 2020Quote: ... the Apoptosis Detection Kit was used (BD Pharmingen, Bedford, USA), and cells were washed and resuspended in binding buffer ...
-
bioRxiv - Immunology 2019Quote: ... Cells were permeabilised with Cytofix/Cytoperm kit (BD Biosciences, USA) accordingly to the manufacturer protocol and stained with monoclonal antibodies targeting IFN-γ (BD Bioscience ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by mild fixation and permeabilization using the Cytofix and Cytoperm solutions from BD Cytofix/Cytoperm™ Fixation/ Permeabilization Solution Kit (BD biosciences, BDB554714) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then analyzed with BrdU-APC Flow Kit (BD Biosciences) as described previously (24).
-
bioRxiv - Molecular Biology 2021Quote: ... BD Cytofix/Cytoperm™ kit (BD Biosciences, San Jose, CA) was used following the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... fixed and permeabilized using Fixation/Permeabilization Solution Kit (BD Biosciences) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and stained using a PE BrdU flow kit (BD Biosciences). For coculture experiments and proliferation experiments ...
-
bioRxiv - Immunology 2019Quote: ... Barcoded oligo-conjugated antibodies (single-cell multiplexing kit; BD Biosciences) were used to infer origin of sample (ie ...
-
bioRxiv - Neuroscience 2021Quote: The cytokine bead array mouse inflammation kit (BD Biosciences, USA) was used for the determination of cytokine levels in brain lysate and plasma samples according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... followed by permeabilization with Cytofix/cytoperm kit solution (BD Biosciences) and staining with anti-IFN-γ (BD Biosciences Cat#554702) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The FITC Annexin-V Apoptosis Detection kit I (BD Pharmingen) was used for the staining following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... fixed and permeabilized with the Cytofix/Cytoperm Kit (BD Biosciences), and stained for intracellular IFNγ using APC-XMG1.2 (eBioscience).
-
bioRxiv - Immunology 2020Quote: ... fixed and permeabilized with an intracellular cytokine staining kit (BD) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... permeabilized with cytofix/cytoperm Kit (BD Biosciences, Cat. no: 554714), and then stained with anti-Ki-67 antibody ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed using fixation solution (BD, FoxP3 staining kit) for 30 min and washed twice using FACS buffer ...
-
bioRxiv - Physiology 2021Quote: ... Annexin V-FITC apoptosis detection kit (BD Biosciences, 0076884, USA) was used to analyze hepatocyte apoptosis according to manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: The PE Annexin V Apoptosis detection kit I (BD, Germany) was used to analyze cell viability following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Infected cells were fixed with cytofix/cytoperm kit (BD Pharmingen) and stained using the indicated primary and secondary antibodies ...
-
bioRxiv - Immunology 2021Quote: ... and stained according to BD Cytofix/Cytoperm Kit (BD Biosciences) or the FoxP3/Transcription Factor Staining Buffer Set (Thermo Fisher).
-
bioRxiv - Immunology 2021Quote: ... fixed and were stained with Phosflow staining kit from BD Biosciences using manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... fixed and permeabilized using the cytofix/cytoperm kit (BD Biosciences), and intracellularly stained for IFN-γ ...
-
bioRxiv - Immunology 2022Quote: ... Barcoded oligo-conjugated antibodies (single-cell multiplexing kit; BD Biosciences) were used to infer the origin of sample (i.e ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-KIT rat monoclonal antibody (BD Biosciences, 553352, 1:200), anti-DDX4 rabbit polyclonal antibody (abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Annexin V Apoptosis Detection Kit I (BD Bioscience, #559763) was used as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and processed using BD Rhapsody™ Cartridge Reagent Kit (BD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed in BD Cytofix/Cytoperm kit (BD Biosciences) for 10 minutes and intracellular proteins were subsequently stained overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... except cells were permeabilized using Cytofix/Cytoperm kit (BD Biosciences) before adding the antibodies and during the following procedure ...
-
bioRxiv - Immunology 2023Quote: ... cells were permeabilized using the Cytofix/Cytoperm kit (BD Biosciences) for 5–8 minutes at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... with Mouse/Rat Soluble Protein Master Buffer Kit (BD 558266).
-
bioRxiv - Immunology 2023Quote: ... fixed and permeabilized using a Cytofix Cytoperm kit (BD Bioscience) and incubated with mouse monoclonal antibody anti-IFNγ ...
-
bioRxiv - Immunology 2023Quote: ... cells were permeabilized using the Cytofix/Cytoperm kit (BD Biosciences), and incubated with intracellular antibodies ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then the BrdU Flow Kit staining protocol (BD Biosciences) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... or BD Cytofix/ Cytoperm Kit (BD Biosciences, San Jose, CA), according to the manufacturers’ protocols ...
-
bioRxiv - Immunology 2023Quote: ... Developing was performed using the IFNγ-ELISpot kit (BD Biosciences) and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Infected cells were fixed with cytofix/cytoperm kit (BD Pharmingen). Cells were washed three times with wash buffer ...
-
bioRxiv - Microbiology 2024Quote: ... and fixed/permeabilized with the Cytofix/Cytoperm kit (BD Bioscience). Cells were then stained for 30min on ice with Alexa-Fluor-488-conjugated mouse monoclonal antibody (mAb ...
-
bioRxiv - Immunology 2024Quote: ... or the BD fixation/permeabilization solution kit (#554714, BD BioSciences) according to the manufacturer’s protocols and then incubated with a cocktail of antibodies against intracellular markers ...
-
bioRxiv - Immunology 2024Quote: ... cells were permeabilized using the Cytofix/Cytoperm kit (BD Biosciences) and incubated with intracellular antibodies ...